Top
Search 닫기

Original Article

Split Viewer

Korean J. Vet. Serv. 2023; 46(4): 315-324

Published online December 30, 2023

https://doi.org/10.7853/kjvs.2023.46.4.315

© The Korean Socitety of Veterinary Service

도축장 출하돈의 돼지써코바이러스 발생율과 유전형 분석

문보미1*ㆍ추금숙1ㆍ김승채2ㆍ김환주2ㆍ김다정2ㆍ김원일2*

전라북도 동물위생시험소1, 전북대학교 수의과대학2

Received: November 28, 2023; Revised: December 3, 2023; Accepted: December 3, 2023

Genotypic diversity and prevalence of Porcine circoviruses for slaughter pigs in Korea

Bo-Mi Moon 1*, Keum-Sook Chu 1, Seung-Chai Kim 2, Hwan-Ju Kim 2, Da-Jeong Kim 2, Won-Il Kim 2*

1Jeollabuk-do Institute of Livestock & Veterinary Research, Jangsu 55632, Korea
2College of Veterinary Medicine, Jeonbuk National University, Iksan 54596, Korea

Correspondence to : Bo-Mi Moon
E-mail: blue9967@korea.kr
https://orcid.org/0000-0001-6496-4165

Won-Il Kim
E-mail: kwi0621@jbnu.ac.kr
https://orcid.org/0000-0002-0465-0794

Received: November 28, 2023; Revised: December 3, 2023; Accepted: December 3, 2023

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

This study was carried out to investigate the genotypic diversity of PCV2 and co-infection of PCV3 in the hilar lymph nodes of 700 randomly-selected slaughter pigs. Fourteen samples per each farm were obtained from 50 farms between February and August in 2022. Of the 50 farms, 44 farms that had been positive for PCV2 by RT-PCR were genotyped. As a result of PCV2 genotyping, positive rate of PCV2 DNA was 62.3% (436/700). Among the PCV2 DNA-positive samples, positive rate of a single PCV2 genotype was 79.1% (345/436), while multiple PCV2 genotypes were only detected in 20.9% (91/436). Of the 436 single infection cases, PCV2d genotype was most prevalent. Positive rates of PCV2 and PCV3 were 53.6% and 26.0% at the sample level, 5.1% and 8.0% at the farm level, respectively. And the co-positive rate of two viruses was 8.7% (61/700) at the sample level, 62.0% (31/50) at the farm level. These results demonstrate that PCV2 prevalence in slaughter pigs is very high and co-infection between different PCV2 genotypes and between PCV2 and PCV3 is relatively common. Therefore, genetic diversity and co-infection between other porcine circoviruses should be consistently monitored in the future.

Keywords PCV2, PCV3, Prevalence, Slaughterhouse, Co-infection

돼지 써코바이러스(porcine circovirus, PCV)는 Circoviridae과의 Circovirus속에 속하는 enveolop이 없는 단독가닥 DNA 바이러스이며(Tischer 등, 1982), 현재까지 돼지에서 PCV1, PCV2, PCV3, PCV4 등 4가지 다른 종의 PCV가 보고되었다. PCV1은 1974년에 첫 발견되었고 비병원성으로 알려져 있으며(Allan 등, 2012), PCV2는 1990년대 중반 캐나다의 이유후전신성소모성증후군(post-weaning multisystemic wasting syndrome, PMWS) 증상을 보이는 돼지에서 분리되었으며, 돼지 피부염 및 신장증후군(porcine dermatitis and nephropathy syndrome, PDNS), 호흡기 질병 복합증후군(porcine respiratory disease complex, PRDC) 및 번식장애 등을 포함한 다양한 질병과 밀접한 관련이 있다(Rosell 등, 2000; Kim 등, 2003; Opriessing 등, 2007; Grau-Roma 등, 2011). 이와 같이 PCV2 감염은 다양한 병증을 유발하기 때문에 이를 통칭하여 porcine circovirus associated disease (PCVAD)로 명명되고 있다(Allan, 2000). PCV3는 2015년 미국에서 처음 보고되었으며, 기타 세균이나 바이러스 병원체와 관련되어 남미, 유럽, 아시아 등 다른 많은 나라에서 계속 검출되고 있다(Ku 등, 2017; Kwon 등, 2017b; Stadejek 등, 2017; Klaumann 등, 2019; Saraiva 등. 2019; Kim 등, 2020). PCV4는 최근 중국 후난지역에서 PDNS와 비슷한 임상증상을 가진 돼지에서 발견되어 중국과 한국에서 보고되었지만, 분포와 역학에 대해서는 아직 불분명하다(Sun 등, 2021; Kim 등, 2022a).

이 중 PCV2는 양돈산업에서 가장 경제적으로 중요한 질환 중 하나이고, 높은 진화 속도로 인하여 여러 변종이 출현했으며 현재 여러 유전자형으로 분류되고 있다. 그 중 open reading frames (ORF2) 서열에 따라 5가지 유전자형(PCV2a, PCV2b, PCV2c, PCV2d 및 PCV2e)으로 분류된다(Olvera 등, 2007). PCV2a는 1996년부터 2000년대 초반까지 가장 많은 유전형 그룹이었으며, 2000년대 중·후반 PCV2b가 우세해지기 시작했고, PCV2d가 2009년도 중국에서 처음 발견된 이후에는 현재까지는 전 세계적으로 PCV2d가 가장 많은 유전형으로 알려져 있다(Xiao 등, 2015). 현재 국내에서도 PCV2d가 가장 우세하며 PCV2b와 PCV2a가 그 뒤를 따른다(Kwon 등, 2017a; Kim 등, 2018). 반면 PCV2c는 덴마크와 브라질의 보관된 돼지 혈청시료에서만 분리되었다(Dupont 등, 2008). 이후 PCV2e가 2015년 미국에서 새로운 유전자형으로 발견되었으며, 다른 유전형(PCV2a-d)에 비해서 ORF2 서열 내에 12개에서 15개의 추가 서열을 가지고 있다(Davies 등, 2016). 최근 국내에서 PCV2e가 검출 분리되었으나, 아직까지 PCV2e의 발병 기전이나 병원성은 명확히 알려지지 않았다(Park 등, 2020).

PCV 감염증의 경우, 6∼10주령의 어린 돼지에서 황달이나 호흡곤란의 PMWS 증상을 보이며(Chae, 2004; Chae, 2005), 16∼22주령의 육성·비육구간의 돼지에서 여러가지 호흡기 병변을 동반하여 성장부진, 사료효율 감소를 동반하는 PRDC로 변화해가는 양상을 보인다(Chae, 2005; Chae, 2012). 그리고 PCV2의 유전자형들이 혈청시료보다는 폐와 림프절 같은 조직시료에서 더 잘 검출된다고 알려져 있다(Kim 등, 2018; Park과 Chae, 2021). 이러한 이유로 출하시기의 도축돈에서 PCV를 진단하기 위해 폐렴증상의 폐와 폐문림프절을 시료로 선택하여 실험을 진행하였다.

현재 시판되는 PCV2 백신은 대부분 PCV2a에 기반을 둔 백신으로 이전 연구에서 PCV2d에 대한 효과적인 교차 면역능력이 보고되었다. 하지만 최근 여러 새로운 유전자형의 등장과 PCV3의 복합감염으로 인하여 기존백신에 대한 효능이 이전과는 달리 일관적이지 않아 다른 전신성 돼지질병의 감염을 초래하거나 농장 내 병원성의 변이가 일어날 가능성도 없지 않다. 또한 현재 대부분의 농장에서 상용 PCV2 백신을 접종함에도 불구하고 9∼10주령 이상의 육성·비육돈에서 야외감염이 지속적으로 발생하는 상황으로 이에 대한 원인 파악과 대비책 마련이 필요하다(Fragile 등 2012; Shen 등, 2012; Oliver-Ferrando 등, 2016).

본 연구에서는 특히 최근 감염율이 증가하는 출하돈의 PCV2 감염실태를 파악하기 위하여 도축장 출하돈의 폐문림프절에서 RT-PCR을 이용하여 농장별 PCV2 양성율을 조사하였고, 다음으로 PCV2의 genotying을 실시하여 PCV2의 유전자형(PCV2a, PCV2b, PCV2d, PCV2e)의 유병률과 더불어 PCV3의 복합 감염상황을 함께 조사하여 농가 방역지도의 기초 자료로 활용하고자 실험을 실시하였다.

공시재료 및 핵산추출

본 연구에서는 2022년 2월부터 8월까지 축산물작업장 3개소에 도축 의뢰된 도내 양돈농가 중 50호를 선별하여 180~210일령의 도축돈 가운데 육안상 폐렴 소견이 있다고 판단되는 개체를 농장별 14두씩 총 700점의 돼지 폐문림프절을 채취하여 실험 재료로 사용하였다.

이 폐문림프절을 균질화하여 5% phosphate-buffered saline (PBS) 부유액을 원심분리하고 그 상층액을 Patho Gene-spin™ DNA/RNA Extraction Kit (iNtROn Biotechnology, Korea)를 이용하여 제조사의 추천 방법에 따라 DNA를 추출하였다.

PCV2 검출 및 유전형 분석

1차로 PCV2 양성농장 스크리닝을 위해서 PowerChek® PRRS/PCV2 Real-time PCR kit를 이용하여 제조사의 술식에 따라 RT-PCR을 실시하였다. 이후 PCV2양성이 확인된 44개의 농장에 대해서만 genotyping을 실시하였으며 총 4쌍의 primer를 사용하였다(Table 1). PCV2 검사는 추출한 nucleotides 2 μL와 각 primer 1 μL (10 pmol)를 Maxime PCR premix (iNtROn Biotechnology, Korea)에 첨가하여 진행하였다. PCV2a, PCV2b 및 PCV2d 유전형 감별을 위하여 이전에 보고된 대로 94℃에서 1분 반응시킨 다음, 94℃에 30초, 60℃에 30초 및 72℃에 1분씩 35회 반복 반응시킨 후 최종 72℃에서 10분간 반응시켰다(Kim 등, 2018). PCV2e를 검출하기 위해서는 95℃에서 5분 반응시킨 다음, 95℃에 30초, 60℃에 40초 및 72℃에 1분씩 35회 반복 반응시킨 후, 최종 72℃에서 10분간 반응시켰다(Park과 Chae, 2021). PCR이 완료되면 반응액 7 μL를 1.5% agarose gel (ethidium bromide 0.5μg/mL in DW)에 100 bp DNA Marker와 같이 TAE buffer가 함유된 전기영동 tank에 gel을 침적시킨 후 150 V/cm, 30분간 전기영동을 실시하여 자외선 하에서 특이 band 증폭 유무를 확인하였다.

Table 1 . List of primers used in this study

Primer nameNucleotide sequence (5’-3’)PurposeProduct size (bp)Primer location (nt)Reference
PCV2ab 2NFGGTTGGAAGTAATCAATAGTGGAPCV2a-specific2771209∼1231Kwon et al, 2017a
PCV2a 2NRGGGGAACCAACAAAATCTC1467∼1485Hesse et al, 2008
PCV2ab 2NFGGTTGGAAGTAATCAATAGTGGAPCV2b-specific2771209∼1231Kwon et al, 2017a
PCV2b 2NRGGGGCTCAAACCCCCGCTC1466∼1484Hesse et al, 2008
PCV2d 2NFGGTTGGAAGTAATCGATTGTCCTPCV2d-specific3431208∼1230Kwon et al, 2017a
PCV2d 2NRTCAGAACGCCCTCCTGGAAT1531∼1550
PCV2e 2NFGGTTTGGGGGTGAAATATCGGPCV2e-specific3281251∼1271Park et al, 2020
PCV2e 2NRCTGTTGTAACCTCCACAGTCAC1557∼1578
PCV3-FTTACTTAGAGAACGGACTTGTAACGPCV3 detection649Ku et al, 2017
PCV3-RAAATGAGACACAGAGCTATATTCAG


PCV3 검출

50개 농장의 700개 시료로부터 추출한 DNA에 대하여 Maxime PCR premix (iNtROn Biotechnology, Korea)를 이용하여 PCV3를 검출하는 primer 1 μL (10 pmol)를 첨가하여 진행하였다(Table 1). PCV3의 검출하기 위한 PCR 조건은 94℃에서 2분 반응시킨 다음, 94℃에 30초, 56℃에 30초 및 72℃에 1분씩 35회 반복 반응시킨 후, 최종 72℃에서 10분간 반응시켰다(Ku 등, 2017).

PCV2 유병률 및 유전형 분포

2022년 2월부터 8월까지 축산물작업장 3개소에 출하된 50개 농장으로부터 700개 폐문림프절을 채취하여 RT-PCR을 실시하였으며 PCV2 양성이 확인된 44개 농장을 대상으로 genotyping을 실시한 결과, PCV2 유병률은 시료 수준에서는 62.3% (436/700), 농장 수준에서는 88% (44/50)로 확인되었다.

Fig. 1A에서 볼 수 있듯이 PCV2 양성인 44개 농장 중 22개 농장(44%)은 단독감염이고, 22개 농장(44%)은 2개의 유전형이 함께 혼합된 복합감염으로 나타났다(Table 2). 단독감염 농장의 경우, PCV2d가 가장 많은 부분을 차지했고(16/44, 36.4%), 그 다음은 PCV2a (3/44, 6.8%), PCV2b (2/44, 4.5%) 및 PCV2e (1/44, 2.3%) 순이었다. 복합감염 농장의 경우는 PCV2b와 PCV2d가 복합감염이 가장 많았고(5/44, 11.4%), PCV2a와 PCV2d, PCV2d와 PCV2e, PCV2a와 PCV2d 및 PCV2e (4/44, 9.1%), PCV2a와 PCV2e (3/44, 6.8%), PCV2a와 PCV2b 및 PCV2e, PCV2a와 PCV2b, PCV2d, 및 PCV2e (1/44, 2.3%) 순으로 나타났다. 또한, 시료 수준에서 살펴보면, 436개의 PCV2 양성시료 중 345개(79.1%)가 단독 감염이고, 91개(20.9%)가 복합감염으로 나타났다. 단독감염 시료 중 PCV2d가 가장 많은 부분을 차지했고(255/436, 58.5%), 그 다음은 PCV2a (40/436, 9.2%), PCV2b (28/436, 6.4%), PCV2e (22/436, 5.0%) 순이었다. 복합감염 시료의 경우는 PCV2d와 PCV2e가 가장 많았고(25/436, 5.7%), PCV2a와 PCV2d (21/436, 4.8%), PCV2a와 PCV2e (18/436, 4.1%), PCV2b와 PCV2d (18/436, 4.1%), PCV2a와 PCV2b 및 PCV2d (7/436, 1.6%), PCV2a와 PCV2d 및 PCV2e (2/436, 0.5%)순으로 나타났다(Fig. 1B, 1C, Table 3).

Table 2 . Information of tested farms and their infection status of porcine circovirus type 2 (PCV2) and PCV3

Farm IDSample collection dateLocation of farmInfection Status of PCV2PCV2 genotypes detectedPositive rate of PCV2 (RT-PCR)Average Ct valuePositive rate of PCV3
Farm 12022.02.16WanjuMultiplebd100% (14/14)20.56±0.728.6% (4/14)
Farm 22022.02.16IksanMultipleabd100% (14/14)18.3±0.8421.4% (3/14)
Farm 32022.02.17JeongeupMultipleae100% (14/14)19.25±1.0614.3% (2/14)
Farm 42022.02.17JeongeupNegative0% (0/14)0% (0/14)
Farm 52022.02.22NamwonMultiplead100% (14/14)20.82±0.480% (0/14)
Farm 62022.02.24JeonjuSingleb100% (14/14)27.34±1.370% (0/14)
Farm 72022.02.25GimjeSingled85.7% (12/14)23.63±1.397.1% (1/14)
Farm 82022.02.25WanjuSinglea71.4% (10/14)21.22±1.110% (0/14)
Farm 92022.02.25JeongeupMultipleade92.9% (13/14)26.59±1.147.1% (1/14)
Farm 102022.03.03IksanSingled100% (14/14)21.88±0.7228.6% (4/14)
Farm 112022.03.03IksanMultiplebd100% (14/14)21.27±1.2878.6% (11/14)
Farm 122022.03.03SunchangMultiplede71.4% (10/14)29.34±1.2421.4% (3/14)
Farm 132022.03.10JangsuMultiplebd100% (14/14)23.68±1.290% (0/14)
Farm 142022.03.10JeongeupMultipleade100% (14/14)23.29±0.7614.3% (2/14)
Farm 152022.03.10JinanMultiplead100% (14/14)22.99±1.1214.3% (2/14)
Farm 162022.03.30NamwonMultiplead100% (14/14)23.72±0.7621.4% (3/14)
Farm 172022.03.30JinanSingled100% (14/14)22.58±0.727.1% (1/14)
Farm 182022.04.25ImsilMultipleade92.9% (13/14)22.37±0.9821.4% (3/14)
Farm 192022.04.25NamwonSingled85.7% (12/14)24.97±1.430% (0/14)
Farm 202022.04.25IksanMultiplede100% (14/14)25.92±0.957.1% (1/14)
Farm 212022.04.26IksanMultipleabde100% (14/14)23.71±0.6528.6% (4/14)
Farm 222022.04.26NamwonMultipleae100% (14/14)27.18±1.47.1% (1/14)
Farm 232022.04.28WanjuNegative0% (0/14)7.1% (1/14)
Farm 242022.04.28IksanSingled28.6% (4/14)25.36±2.077.1% (1/14)
Farm 252022.04.28GochangMultiplede100% (14/14)30.62±1.067.1% (1/14)
Farm 262022.05.10NamwonNegative0% (0/14)0% (0/14)
Farm 272022.05.10ImsilSingled50% (7/14)27.3±1.2521.4% (3/14)
Farm 282022.05.12NamwonSinglee21.4% (3/14)32.31±0.9814.3% (2/14)
Farm 292022.05.12NamwonSingled100% (14/14)29.78±1.330% (0/14)
Farm 302022.05.16WanjuSingled78.6% (11/14)25.27±1.287.1% (1/14)
Farm 312022.05.16GimjeMultiplead85.7% (12/14)29.2±1.110% (0/14)
Farm 322022.05.16IksanSingled78.6% (11/14)25.67±0.80% (0/14)
Farm 332022.05.24WanjuMultiplebd35.7% (5/14)29.05±2.9550% (7/14)
Farm 342022.05.24ImsilNegative0% (0/14)14.3% (2/14)
Farm 352022.05.24JeongeupSingled92.9% (13/14)24.42±1.0614.3% (2/14)
Farm 362022.05.24JeongeupNegative0% (0/14)21.4% (3/14)
Farm 372022.06.15IksanSingled57.1% (8/14)23.5±1.2721.4% (3/14)
Farm 382022.06.15MujuSingled42.9% (6/14)28.29±2.1321.4% (3/14)
Farm 392022.06.15ImsilNegative0% (0/14)28.6% (4/14)
Farm 402022.06.15GimjeSingled57.1% (8/14)25.37±2.140% (0/14)
Farm 412022.06.27WanjuSingled57.1% (8/14)29.51±1.130% (0/14)
Farm 422022.06.27IksanMultipleade50% (7/14)22.71±1.490% (0/14)
Farm 432022.06.27WanjuMultiplebd85.7% (12/14)25.29±0.8614.3% (2/14)
Farm 442022.07.14JinanMultiplede85.7% (12/14)24.28±1.0635.7% (5/14)
Farm 452022.07.14JeongeupSingled85.7% (12/14)25.9±0.8442.9% (6/14)
Farm 462022.07.14JinanSinglea28.6% (4/14)29.94±2.737.1% (1/14)
Farm 472022.07.14JeongeupSinglea85.7% (12/14)20.7±0.9221.4% (3/14)
Farm 482022.07.14GimjeSingled92.9% (13/14)24.08±1.120% (0/14)
Farm 492022.07.14IksanMultipleae64.3% (9/14)24.75±0.840% (0/14)
Farm 502022.07.21IksanSingleb14.3% (2/14)32.12±1.017.1% (1/14)


Table 3 . Prevalence and co-infection status of different genotypes of porcine circovirus type 2 and their co-infection status with PCV3 based on the PCV2-positive samples

PCV2 genotypeSamples levelFarms levelPCV3 co-infection (samples/farms)
2a409.2%36.8%1 (1/40, 2.5%)2 (2/3, 66.7%)
2b286.4%24.5%4 (4/28, 14.3%)1 (1/2, 50.0%)
2d25558.5%1636.4%33 (33/255, 12.9%)10 (10/16, 62.5%)
2e225.0%12.3%4 (4/22, 18.2%)1 (1/1,100.0%)
2b, 2d184.1%511.4%4 (4/18, 22.2%)4 (4/5, 80.0%)
2a, 2d214.8%49.1%2 (2/21, 9.5%)2 (2/4, 50.0%)
2d, 2e255.7%49.1%6 (6/25, 24.0%)4 (4/4, 100.0%)
2a, 2e184.1%36.8%4 (4/18, 22.2%)2 (1/3, 66.7%)
2a, 2b, 2d71.6%12.3%3 (3/7, 42.9%)1 (1/1,100.0%)
2a, 2d, 2e20.5%49.1%03 (3/4, 75.0%)
2a, 2b, 2d, 2e00.0%12.3%01 (1/1,100.0%)


Fig. 1.Infection status of porcine circovirus 2 (PCV2) genotypes in 50 pig farms. (A) Single or multiple infection status at the farm level, (B) infection pattern of different PCV2 genotypes at the farm level, (C) infection pattern of different PCV2 genotypes at the sample level. The small letters a, b, c, d, and e represent PCV2a, PCV2b, PCV2c, PCV2d, and PCV2e genotypes, respectively. Two or more small letters indicate co-infection of different genotypes of PCV2.

1차 PCV2 양성농장 스크리닝을 위한 RT-PCR 결과로 PCV2가 검출된 농장의 평균 Ct값은 낮게는 18.3±0.84부터 높게는 32.31±0.98로 확인되었다(Table 2). 감염된 genotype별 PCV2의 농장단위별 평균 검출 Ct값을 보면 단독감염 중 PCV2d 감염이 PCV2b나 PCV2e 단독감염에 비해 더 낮은 값을 보였고, 일반적으로 복합감염이 많이 이루어져 있을수록 검출 평균 Ct값이 낮은 것을 확인할 수 있었다(Fig. 2).

Fig. 2.Distribution of Ct value generated by RT-PCR assay from porcine circovirus type 2 (PCV2)-positive samples. (A) Ct values by PCV2 infection pattern at the farm level, (B) Ct values by PCV2 infection pattern at the sample level.

PCV3 유병률 및 복합감염 상황

50개 농장의 700개 폐문림프절 시료 중에서, 35개 농장(70.0%)의 97개 시료(13.9%)가 PCV3 양성이었다. PCV2와 PCV3의 시료 및 농장 수준별 복합 감염률을 살펴보면, PCV2만 단독 감염된 경우는 시료 수준에서는 53.6% (375/700), 농장 수준에서는 26.0% (13/50)로 시료 수준에서의 복합 감염률이 더 높았고, PCV3만 단독 감염된 경우는 시료 수준에서는 5.1% (36/700), 농장 수준에서는 8.0% (4/50)였으며, PCV2와 PCV3가 복합 감염된 경우는 시료 수준에서는 8.7% (61/700)이고 농장 수준에서는 62.0% (31/50)로 농장 수준에서의 복합 감염률이 훨씬 높았다(Fig. 3).

Fig. 3.Positive rate and co-infection status of porcine circovirus type 2 (PCV2) and PCV3. (A) Positive rates at the sample level. (B) Positive rates at the farm level.

PCV2는 PMWS의 원인체로 알려져 있으며, 1991년 캐나다에서 최초로 발생 보고된 이후, 전 세계적으로 문제시되고 있는 바이러스이다(Morozov 등, 1998; Allan 등, 2000). 현재에도 양돈산업을 하는 여러 국가에 높은 발병률로 존재하고 있어 경제적으로 큰 피해를 주는 질병 중 하나이다. 현재는 써코바이러스 관련질병(Porcine circovirus associated disease; PCVAD)의 병원성과 관계되는 것으로 알려졌으며 이와 관련된 여러 가지 유전형들에 대한 변이와 유전학적 조사 또한 계속되고 있다. PCV3는 피부염이나 번식 장애가 있는 돼지에서 처음 발견된 이후로 해당 바이러스에 관한 연구가 지속되고 있으며, 한국을 포함한 세계 각국에서 보고되고 있다. 본 연구에서는 2022년 2월부터 8월에 걸쳐 전북지역 도축돈의 폐문림프절에서 PCV2의 양성률과 유전형의 분포를 확인하고 더불어 PCV3의 복합 감염률도 함께 조사하였다.

돼지는 3주령에 PCV2 백신을 접종하고 23주 후에는 PCV2 항체 수치가 감소하여 PCV2 감염에 대한 감수성이 더 상승한다. 따라서 도축돈의 림프절 검사는 양돈장에서 PCV2 감염의 좋은 지표가 된다(Park과 Chae, 2021). 반면 도축돈의 림프절 표본 추출의 단점은 농장의 임상증상 및 생산 지표를 알 수 없다는 단점이 있다. 이러한 단점을 극복하고 유병률 검사에 대한 신뢰성을 더욱 확보하기 위해서는 혈청학적 검사로 보완하기도 한다.

현재까지 5개의 PCV2 유전자형(PCV2a, 2b, 2c, 2d 및 2e)이 확인되었으며, 국내 양돈산업에 확인된 PCV2의 유전형은 PCV2a, PCV2b, PCV2d, PCV2e 등 총 4종이다. 본 연구 결과에서도 PCV2d는 국내 사육돈군에서 가장 우세한 유전형으로 가장 높은 유병률을 보이며, 새로 출현한 PCV2e는 가장 낮은 유병률을 보인다(Fig. 1). 그 중 PCV2d는 PCV2a 및 2b보다 돼지에서 더 심각한 임상증상을 유발하는 것으로 알려져 있다(Grierson 등, 2004; Guo 등, 2010). 이 연구에서는 PCV2d 유전형의 단독감염 시료에 대비하여 PCV2d를 포함한 복합감염 시료에서 RT-PCR로 더 낮은 Ct값이 검출되는 것을 확인하였다(Table 2, Fig. 2). 이는 한 그룹 내에 PCV2 유전자형이 동시에 같이 존재하고 순환한다는 것 자체가 병원성 변이에도 영향을 줄 수 있다는 것을 의미한다.

Opriessnig 등(2017)에 따르면, 현재 PCV2a에 기반을 둔 PCV2 백신은 PCV2d 바이러스혈증 등을 경감시키는 데 효과가 있으며 이러한 PCV2 백신들이 PCV2d를 효과적으로 교차 방어할 수 있다고 보고하고 있다. 그러나 최근 Kang 등(2021)의 연구 결과에 따르면, PCV2a 면역 돼지의 항혈청과 PCV2d 분리주는 서로 다른 중화능이 관찰되며, 현재 농장에서 순환하고 있는 PCV2에 대한 일관적이지 못한 PCV2 백신의 효능에 대한 문제가 야기되면서, 차세대 subunit 백신 후보로서의 PCV2d-VLPs (virus-like particles)가 써코바이러스의 다양한 유전형의 방어에 더 효과적이라고 보고하였다.

최근에 북미에서 확인된 PCV3는 번식 장애(Ku 등, 2017; Palinski 등, 2017), 심장 및 전신성 염증(Phan 등, 2016), 복합적 호흡기 질환(Shen 등, 2018) 등과 관련이 있으며, 최근에 미국, 중국, 한국에서 다양한 임상 사례에서 확인되었고(Ku 등, 2017; Kwon 등, 2017b; Palinski 등, 2017), 꾸준히 연구 및 조사가 진행되고 있다. 중국의 한 연구에 따르면 Ku 등(2017)은 PCV3 유병률을 시료 수준에서는 34.7%, 농장 수준에서 68.6%로 보고하였으며, PCV3가 뇌(73.5%), 폐(66.7%), 림프절(36.6%), 편도(66.7%), 정액(8.5%), 혈청(28.7%) 등 다양한 시료에서 검출됨을 보고하고 수직 전파의 가능성을 언급했다. 국내에서는 Kim 등(2018)의 PCV3 연구 결과에 의하면 시료 수준에서는 44.2%, 농장 수준에서는 72.6%로 검출됨을 보고하였다. 또한 Kim 등(2022b)에 따르면 triplex real-time PCR을 이용하여 PCV2, PCV3, PCV4의 유병률과 복합감염 실태를 조사하였는데, 단독감염은 각각 28.8%, 44.4%, 9.6%이고, PCV2와 PCV3의 복합감염은 12.6%, PCV2와 4의 복합감염은 3.5%, PCV3와 4의 복합감염은 5.1%이며, 3가지 타입에 모두 감염된 경우는 1.5%였다. 본 연구에서도 PCV2와 PCV3의 양성률은 각 농장으로부터 채취된 시료의 수에 의해 영향을 받기 때문에, 유병률 계산 시 편차를 최소화하기 위해서 시료 수준 및 농장 수준에서 분석하였다. 본 연구에서 도축돈의 폐문림프절을 대상으로 PCV2와 PCV3의 유병률을 조사한 결과, 시료 수준에서는 62.3% 및 13.9% 그리고 농장 수준에서는 88.0% 및 70%로 각각 확인되었고, 이 PCV2와 PCV3의 복합감염 유병률은 시료 수준에서는 8.7%, 농장 수준에서는 62.0%로 각각 나타났다. 개별 시료 수준보다 농장 수준의 유병률이 더 높은 것은 향후 PCV3 감염 혹은 PCV2와 PCV3의 복합감염이 국내 양돈농가에서 풍토적으로 발생할 가능성이 높다는 것을 의미한다. 또한 본 연구의 PCV2의 높은 유병률은 도내 양돈농가의 비육돈이 출하되기까지 전반적으로 PCV2 감염이 광범위하게 분포된 것으로 보이며, PCV3 또한 향후 농가에 발생할 가능성이 큰 상황이다.

PCV2와 PCV3의 유병률과 복합감염률에 대한 최근 국내 연구 결과와 이번 연구 결과의 차이에 대한 부분은 계절, 연령, 시료 종류, 채취 장소 등과 관련이 있다. Shen 등(2012)의 연구 결과에 따르면 모체이행항체의 감소로 인해 육성, 비육단계의 돼지들이 PCV2에 더 높은 감수성을 보이는 것으로 나타났다. 또한 Jia 등(2022)에 의하면 시료 채취 기간 중 가장 온도가 낮은 시기인 1월부터 3월에 PCV2의 유병률이 92.39%로 가장 높았고, 가장 따뜻한 시기인 7월부터 9월에 PCV2 유병률이 62.67%로 가장 낮았으며, 반면 PCV3의 유병률은 61.6%로 가장 높았다.

중국에서 설사 증상이 있는 자돈의 장 조직으로 PCV2와 PCV3와 PEDV (porcine epidemic diarrhea virus)의 복합감염률을 조사했을 때 거의 모든 개체가 복합감염 양상을 보였고, 단독감염률은 각각 2.63%, 3.95%, 6.58%로 아주 저조했다. PCV2는 PCV2-systemic disease (PCV2-SD)로 인한 장관 질병과 연관이 있으며, PCV3의 경우는 병원성은 밝혀지지 않았지만, 최근 설사 증상을 보이는 이유자돈 시료에서도 검출되었다는 보고가 있다(Qi 등, 2019). 이처럼 PCV2와 PCV3의 복합감염은 호흡기 질병뿐만 아니라 다른 돼지 질병의 발생과도 관련이 있다. 그러므로 본 연구에서 대상 범위가 2가지의 돼지써코바이러스의 유병률과 복합감염에 한정되어 조사하였더라도, 향후 PRRSV (Porcine reproductive and respiratory syndrome virus)나 PEDV와 같은 다른 병원체와의 복합감염에 관한 연구도 필요하다.

Woźniak 등(2019)의 연구 결과에 의하면 PCV2 백신 접종 유무와 PCV2의 감염 수준은 PCV3 감염에 영향을 미치지 않는다. 이는 PCV2의 백신 접종을 하지 않고, PCV2의 감염 수준이 높다고 해도 PCV3 감염을 증가시키지는 않는다는 의미이다. 또한 이는 PCV3 감염이 이루어지지 않도록 별도의 예방 대책이 필요하다는 것을 의미한다. 그러므로 PCV2의 신규 백신을 개발할 때는 PCV2a 기반의 백신을 PCV2d로의 업데이트와 더불어 PCV3를 같이 방어할 수 있는 서브 유닛 백신 개발도 필요하다고 생각한다.

본 연구에서는 50개 양돈장의 도축돈 700 마리에서 폐문림프절을 채취하여 Real-time PCR과 genotyping을 통해 PCV2와 PCV3의 유병률과 PCV2의 유전형 분포를 조사하였다. 그 결과, 44개 농장 436두에서 PCV2 DNA가 확인되어 시료 수준에서 62.3%, 농장 수준에서 88%의 양성률을 보였다.

PCV2 양성인 44개 농장 중 22개 농장은 1개 유전형이 단독감염되었으며, 22개 농장은 2개 이상 유전형이 복합감염된 것으로 나타났다. 단독감염 농장의 경우, PCV2d의 시료 및 농장 수준 양성률이 각각 36.4% 및 58.5%로 가장 높았으며, PCV2e가 가장 낮은 양성률을 보였다.

PCV2 양성 농장 검출을 위해 실시한 RT-PCR 결과로, 농장의 평균 Ct값은 PCV2d 단독감염이 PCV2b나 PCV2e 단독감염에 비해 더 낮으며 일반적으로 단독감염보다 복합감염이 더 낮은 Ct값을 나타냈다.

PCV3는 50개 농장 700개 폐문림프절 시료 중에서, 35개 농장(70.0%)의 97개 시료(13.9%)에서 검출되었다. PCV2와의 복합감염 상황을 조사한 결과, 시료 수준에서 8.7% (61/700) 및 농장 수준에서 62.0% (31/50)로 확인되어 농장 수준에서의 복합감염 비율이 훨씬 높았다. 이는 향후 농장 내 PCV3의 감염 또는 PCV2와의 복합감염이 더욱 상재화 될 가능성이 있다는 것을 의미한다.

한국 농장의 높은 PCV2 및 PCV3 감염률을 고려할 때 육성·비육돈 및 출하돈에 대한 지속적인 유병률 검사는 물론 다양한 유전형 발생에 대한 변이 감시와 함께 다른 돼지 질병과의 복합감염에 대한 연구도 필요하다고 생각된다.

No potential conflict of interest relevant to this article was reported.

  1. Allan G and Ellis J. 2000. Porcine circoviruses: A review. J Vet Diagn Invest 12:3-14.
    Pubmed CrossRef
  2. Allan G, Krakowka S, Charreyre C. 2012. Discovery and evolving history of two genetically related but phenotypically different viruses, porcine circoviruses 1 and 2. Virus Res 164:4-9.
    Pubmed CrossRef
  3. Chae C. 2004. Postweaning multisystemic wasting syndrome: a review of aetiology, diagnosis and pathology. Vet J 168:41-49.
    Pubmed CrossRef
  4. Chae C. 2005. A review of porcine circovirus 2-associated syndromes and diseases. Vet J 169:326-336.
    Pubmed CrossRef
  5. Chae C. 2012. Porcine circovirus type 2 and its associated diseases in Korea. Virus Res 164:107-113.
    Pubmed CrossRef
  6. Davies B, Wang X, Dvorak CM, Murtaugh MP. 2016. Diagnostic phylogenetics reveals a new porcine circovirus 2 cluster. Virus Res 217:32-37.
    Pubmed CrossRef
  7. Dupont K, Nielsen E, Larsen L. 2008. Genomic analysis of PCV2 isolates from Danish archives and a current PMWS case-control study supports a shift in genotypes with time. Vet Microbiol 128:56-64.
    Pubmed CrossRef
  8. Fraile L, Sibila M, Nofrarias M, Lopez-Jimenez R, Huerta E, Llorens A, Lopez-Soria S, Segales J. 2012. Effect of sow and piglet porcine circovirus type 2 (PCV2) vaccination on piglet mortality, viraemia, antibody titre and production parameters. Vet Microbiol 161:229-34.
    Pubmed CrossRef
  9. Grau-Roma L, Segales J. 2011. Recent advances in the epidemiology, diagnosis and control of diseases caused by porcine circovirus type 2. Vet J 187:23-32.
    Pubmed CrossRef
  10. Grierson SS, King DP, Sandvik T, Hicks D, Spencer Y, Banks M. 2004. Detection and genetic typing of type 2 porcine circoviruses in archived pig tissues from the UK. Arch Virol 149:1171-1183.
    Pubmed CrossRef
  11. Guo LL, Lu YH, Wei YW, Liu CM. 2010. Porcine circovirus type 2 (PCV2): Genetic variation and newly emerging genotypes in China. Virology 7:273-284.
    Pubmed KoreaMed CrossRef
  12. Hesse R, Rowland RR. 2008. Evidence for recombination between PCV2a and PCV2b in the field. Virus Res 132:201-207.
    Pubmed CrossRef
  13. Jia Y, Zhu Q, Xu T, Chen X, Li H, Ma M, Zhang Y, Chen H. 2022. Detection and genetic characteristics of porcine circovirus type 2 and 3 in Henan province of China. Mol Cell Probes 61:101790.
    Pubmed CrossRef
  14. Kang SJ, Bae SM, Lee HJ, Jeong YJ, Lee MA, You SH, Lee HS, Hyun BH, Cha SH. 2021. Porcine circovirus (PCV) genotype 2d-based virus-like particles (VLPs) Induced broad cross-neutralizing antibodies against diverse genotypes and provided protection in dual-challenge infection of a PCV2d virus and a type 1 porcine reproductive and respiratory syndrome virus (PRRSV). Pathogens 10:1145.
    Pubmed KoreaMed CrossRef
  15. Klaumann F, Correa-Fiz F, Sibila M, Segalés J. 2019. Infection dynamics of porcine circovirus type 3 in longitudinally sampled pigs from four Spanish farms. Vet Rec 184:619-619.
    Pubmed CrossRef
  16. Kim HR, Lim DR, Chae HG, Park JY, Kim SH, Lee KK, Lee C, Park CK. 2020. Advanced target-specific probe-based real-time loop-mediated isothermal amplification assay for the rapid and specific detection of porcine circovirus 3. Transbound Emerg Dis 67:2336-2344.
    Pubmed CrossRef
  17. Kim HR, Park J, Park JH, Kim JM, Baek KS, Kim DY, Park CK. 2022a. Development of a real-time polymerase chain reaction assay for reliable detection of a novel porcine circovirus 4 with an endogenous internal positive control. Korean J Vet Serv 45:1-11.
    CrossRef
  18. Kim HR, Park JH, Kim WI, Park CK. 2022b. Prevalence and co-infection status of three pathogenic porcine circoviruses (PCV2, PCV3, and PCV4) by a newly established triplex real-time polymerase chain reaction assay. Korean J Vet Serv 45:87-99.
    CrossRef
  19. Kim J, Chae C. 2003. Association of porcine circovirus 2 with porcine respiratory disease complex. Vet J. 166:251-256.
    Pubmed CrossRef
  20. Kim SC, Nazki S, Kwon S, Juhng JH, Mun KH, Kim WI. 2018. The prevalence and genetic characteristics of porcine circovirus type 2 and 3 in Korea. BMC Vet Res 14:1-9.
    Pubmed KoreaMed CrossRef
  21. Kwon T, Lee DU, Yoo SJ, Je SH, Lyoo YS. 2017a. Genotypic diversity of porcine circovirus type 2 (PCV2) and genotype shift to PCV2d in Korean pig population. Virus Res 228:24-29.
    Pubmed CrossRef
  22. Kwon T, Yoo SJ, Lyoo YS. 2017b. Prevalence of novel porcine circovirus 3 in Korean pig populations. Vet Microbiol 207:178-180.
    Pubmed CrossRef
  23. Ku X, Chen F, Li P, Wang Y, Yu X, Fan S, Qian P, He Q. 2017. Identification and genetic characterization of porcine circovirus type 3 in China. Transbound Emerg Dis 64:703-708.
    Pubmed KoreaMed CrossRef
  24. Morozov I, Sirinarumitr T, Sorden SD, Halbur P, Morgan M, Paul PS. 1998. Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome. J Clin Microbiol 36:2535-2541.
    Pubmed KoreaMed CrossRef
  25. Oliver-Ferrando S, Segales J, Lopez-Soria S, Callen A, Merdy O, Sibila M. 2016. Evaluation of natural porcine circovirus type 2 (PCV2) subclinical infection and seroconversion dynamics in piglets vaccinated at different ages. Vet Res 47:121.
    Pubmed KoreaMed CrossRef
  26. Olvera A, Segales J. 2007. Molecular evolution of porcine circovirus type 2 genomes: phylogeny and clonality. Virology. 357:175-185.
    Pubmed CrossRef
  27. Opriessnig T, Xiao CT, Halbur PG, Gerber PF, Meng XJ. 2017. A commercial porcine circovirus (PCV) type 2a-based vaccine reduces PCV2d viremia and shedding and prevents PCV2d transmission to naive pigs under experimental conditions. Vaccine 35:248-54.
    Pubmed KoreaMed CrossRef
  28. Park KH, Oh T, Cho H, Chae C. 2020. The first isolation of porcine circovirus type 2e from a Korean pig. Arch Virol 165:2927-2930.
    Pubmed CrossRef
  29. Park KH and Chae CH. 2021. The prevalence of porcine circovirus type 2e (PCV2e) in Korean slaughter pig lymph nodes when compared with other PCV2 genotypes. Transbound Emerg Dis 68:3043-3047.
    Pubmed CrossRef
  30. Palinski R, Pineyro P, Shang PC, Yuan FF, Guo R, Hause BM. 2017. A novel porcine circovirus distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure. J Virol 91:e01879.
    Pubmed KoreaMed CrossRef
  31. Phan T, Giannitti F, Rossow S, Marthaler D, Knutson T, Li L, Deng X, Resende T, Delwart E. 2016. Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation. Virol J 13:1-8.
    Pubmed KoreaMed CrossRef
  32. Rosell C, Segales J, Ramos-Vara JA, Folch JM, Rodriguez-Arrioja GM, Duran CO, Balasch M, Domingo M. 2000. Identification of porcine circovirus in tissues of pigs with porcine dermatitis and nephropathy syndrome. Vet Rec 146:40-43.
    Pubmed CrossRef
  33. Saraiva GL, Vidigal PMP, Assao VS, Fajardo MLM, Loreto ANS, Fietto JLR, Bressan GC, Lobato ZIP, Silva-Júnior A. 2019. Retrospective detection and genetic characterization of porcine circovirus 3 (PCV3) strains identified between 2006 and 2007 in Brazil. Viruses 11:201.
    Pubmed KoreaMed CrossRef
  34. Shen H, Liu X, Zhang P, Wang L, Liu Y, Zhang L, Song C. 2018. Genome characterization of a porcine circovirus type 3 in South China. Transbound Emerg Dis 65:264-266.
    Pubmed CrossRef
  35. Shen HG, Loiacono CM, Opriessnig T. 2012. Age-dependent susceptibility to porcine circovirus type 2 infections is likely associated with declining levels of maternal antibodies. J Swine Health Prod 20:17-24.
  36. Qi S, Su M, Guo D, Li C, Wei S, Sun D. 2019. Molecular detection and phylogenetic analysis of porcine circovirus type 3 in 21 Provinces of China during 2015-2017. Transbound Emerg Dis 66:1004-1015.
    Pubmed CrossRef
  37. Stadejek T, Wozniak A, Biernacka K. 2017. First detection of porcine circovirus type 3 on commercial pig farms in Poland. Transbound Emerg Dis 64:1350-1353.
    Pubmed CrossRef
  38. Sun W, Du Q, Han Z, Bi J, Lan T, Zheng M. 2021. Detection and genetic characterization of porcine circovirus 4 (PCV4) in Guangxi, China. Gene 773:145384.
    Pubmed CrossRef
  39. Woźniak A, Miłek D, Stadejek T. 2019. Does porcine circovirus type 3 (PCV3) interfere with porcine circovirus type 2 (PCV2) vaccine efficacy? Transbound Emerg Dis 66:1454-1461.
    Pubmed CrossRef
  40. Xiao CT, Opriessnig T. 2015. Global molecular genetic analysis of porcine circovirus type 2 (PCV2) sequences confirms the presence of four main PCV2 genotypes and reveals a rapid increase of PCV2d. J Gen Virol 96:1830-1841.
    Pubmed CrossRef

Article

Original Article

Korean J. Vet. Serv. 2023; 46(4): 315-324

Published online December 30, 2023 https://doi.org/10.7853/kjvs.2023.46.4.315

Copyright © The Korean Socitety of Veterinary Service.

도축장 출하돈의 돼지써코바이러스 발생율과 유전형 분석

문보미1*ㆍ추금숙1ㆍ김승채2ㆍ김환주2ㆍ김다정2ㆍ김원일2*

전라북도 동물위생시험소1, 전북대학교 수의과대학2

Received: November 28, 2023; Revised: December 3, 2023; Accepted: December 3, 2023

Genotypic diversity and prevalence of Porcine circoviruses for slaughter pigs in Korea

Bo-Mi Moon 1*, Keum-Sook Chu 1, Seung-Chai Kim 2, Hwan-Ju Kim 2, Da-Jeong Kim 2, Won-Il Kim 2*

1Jeollabuk-do Institute of Livestock & Veterinary Research, Jangsu 55632, Korea
2College of Veterinary Medicine, Jeonbuk National University, Iksan 54596, Korea

Correspondence to:Bo-Mi Moon
E-mail: blue9967@korea.kr
https://orcid.org/0000-0001-6496-4165

Won-Il Kim
E-mail: kwi0621@jbnu.ac.kr
https://orcid.org/0000-0002-0465-0794

Received: November 28, 2023; Revised: December 3, 2023; Accepted: December 3, 2023

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

This study was carried out to investigate the genotypic diversity of PCV2 and co-infection of PCV3 in the hilar lymph nodes of 700 randomly-selected slaughter pigs. Fourteen samples per each farm were obtained from 50 farms between February and August in 2022. Of the 50 farms, 44 farms that had been positive for PCV2 by RT-PCR were genotyped. As a result of PCV2 genotyping, positive rate of PCV2 DNA was 62.3% (436/700). Among the PCV2 DNA-positive samples, positive rate of a single PCV2 genotype was 79.1% (345/436), while multiple PCV2 genotypes were only detected in 20.9% (91/436). Of the 436 single infection cases, PCV2d genotype was most prevalent. Positive rates of PCV2 and PCV3 were 53.6% and 26.0% at the sample level, 5.1% and 8.0% at the farm level, respectively. And the co-positive rate of two viruses was 8.7% (61/700) at the sample level, 62.0% (31/50) at the farm level. These results demonstrate that PCV2 prevalence in slaughter pigs is very high and co-infection between different PCV2 genotypes and between PCV2 and PCV3 is relatively common. Therefore, genetic diversity and co-infection between other porcine circoviruses should be consistently monitored in the future.

Keywords: PCV2, PCV3, Prevalence, Slaughterhouse, Co-infection

서 론

돼지 써코바이러스(porcine circovirus, PCV)는 Circoviridae과의 Circovirus속에 속하는 enveolop이 없는 단독가닥 DNA 바이러스이며(Tischer 등, 1982), 현재까지 돼지에서 PCV1, PCV2, PCV3, PCV4 등 4가지 다른 종의 PCV가 보고되었다. PCV1은 1974년에 첫 발견되었고 비병원성으로 알려져 있으며(Allan 등, 2012), PCV2는 1990년대 중반 캐나다의 이유후전신성소모성증후군(post-weaning multisystemic wasting syndrome, PMWS) 증상을 보이는 돼지에서 분리되었으며, 돼지 피부염 및 신장증후군(porcine dermatitis and nephropathy syndrome, PDNS), 호흡기 질병 복합증후군(porcine respiratory disease complex, PRDC) 및 번식장애 등을 포함한 다양한 질병과 밀접한 관련이 있다(Rosell 등, 2000; Kim 등, 2003; Opriessing 등, 2007; Grau-Roma 등, 2011). 이와 같이 PCV2 감염은 다양한 병증을 유발하기 때문에 이를 통칭하여 porcine circovirus associated disease (PCVAD)로 명명되고 있다(Allan, 2000). PCV3는 2015년 미국에서 처음 보고되었으며, 기타 세균이나 바이러스 병원체와 관련되어 남미, 유럽, 아시아 등 다른 많은 나라에서 계속 검출되고 있다(Ku 등, 2017; Kwon 등, 2017b; Stadejek 등, 2017; Klaumann 등, 2019; Saraiva 등. 2019; Kim 등, 2020). PCV4는 최근 중국 후난지역에서 PDNS와 비슷한 임상증상을 가진 돼지에서 발견되어 중국과 한국에서 보고되었지만, 분포와 역학에 대해서는 아직 불분명하다(Sun 등, 2021; Kim 등, 2022a).

이 중 PCV2는 양돈산업에서 가장 경제적으로 중요한 질환 중 하나이고, 높은 진화 속도로 인하여 여러 변종이 출현했으며 현재 여러 유전자형으로 분류되고 있다. 그 중 open reading frames (ORF2) 서열에 따라 5가지 유전자형(PCV2a, PCV2b, PCV2c, PCV2d 및 PCV2e)으로 분류된다(Olvera 등, 2007). PCV2a는 1996년부터 2000년대 초반까지 가장 많은 유전형 그룹이었으며, 2000년대 중·후반 PCV2b가 우세해지기 시작했고, PCV2d가 2009년도 중국에서 처음 발견된 이후에는 현재까지는 전 세계적으로 PCV2d가 가장 많은 유전형으로 알려져 있다(Xiao 등, 2015). 현재 국내에서도 PCV2d가 가장 우세하며 PCV2b와 PCV2a가 그 뒤를 따른다(Kwon 등, 2017a; Kim 등, 2018). 반면 PCV2c는 덴마크와 브라질의 보관된 돼지 혈청시료에서만 분리되었다(Dupont 등, 2008). 이후 PCV2e가 2015년 미국에서 새로운 유전자형으로 발견되었으며, 다른 유전형(PCV2a-d)에 비해서 ORF2 서열 내에 12개에서 15개의 추가 서열을 가지고 있다(Davies 등, 2016). 최근 국내에서 PCV2e가 검출 분리되었으나, 아직까지 PCV2e의 발병 기전이나 병원성은 명확히 알려지지 않았다(Park 등, 2020).

PCV 감염증의 경우, 6∼10주령의 어린 돼지에서 황달이나 호흡곤란의 PMWS 증상을 보이며(Chae, 2004; Chae, 2005), 16∼22주령의 육성·비육구간의 돼지에서 여러가지 호흡기 병변을 동반하여 성장부진, 사료효율 감소를 동반하는 PRDC로 변화해가는 양상을 보인다(Chae, 2005; Chae, 2012). 그리고 PCV2의 유전자형들이 혈청시료보다는 폐와 림프절 같은 조직시료에서 더 잘 검출된다고 알려져 있다(Kim 등, 2018; Park과 Chae, 2021). 이러한 이유로 출하시기의 도축돈에서 PCV를 진단하기 위해 폐렴증상의 폐와 폐문림프절을 시료로 선택하여 실험을 진행하였다.

현재 시판되는 PCV2 백신은 대부분 PCV2a에 기반을 둔 백신으로 이전 연구에서 PCV2d에 대한 효과적인 교차 면역능력이 보고되었다. 하지만 최근 여러 새로운 유전자형의 등장과 PCV3의 복합감염으로 인하여 기존백신에 대한 효능이 이전과는 달리 일관적이지 않아 다른 전신성 돼지질병의 감염을 초래하거나 농장 내 병원성의 변이가 일어날 가능성도 없지 않다. 또한 현재 대부분의 농장에서 상용 PCV2 백신을 접종함에도 불구하고 9∼10주령 이상의 육성·비육돈에서 야외감염이 지속적으로 발생하는 상황으로 이에 대한 원인 파악과 대비책 마련이 필요하다(Fragile 등 2012; Shen 등, 2012; Oliver-Ferrando 등, 2016).

본 연구에서는 특히 최근 감염율이 증가하는 출하돈의 PCV2 감염실태를 파악하기 위하여 도축장 출하돈의 폐문림프절에서 RT-PCR을 이용하여 농장별 PCV2 양성율을 조사하였고, 다음으로 PCV2의 genotying을 실시하여 PCV2의 유전자형(PCV2a, PCV2b, PCV2d, PCV2e)의 유병률과 더불어 PCV3의 복합 감염상황을 함께 조사하여 농가 방역지도의 기초 자료로 활용하고자 실험을 실시하였다.

재료 및 방법

공시재료 및 핵산추출

본 연구에서는 2022년 2월부터 8월까지 축산물작업장 3개소에 도축 의뢰된 도내 양돈농가 중 50호를 선별하여 180~210일령의 도축돈 가운데 육안상 폐렴 소견이 있다고 판단되는 개체를 농장별 14두씩 총 700점의 돼지 폐문림프절을 채취하여 실험 재료로 사용하였다.

이 폐문림프절을 균질화하여 5% phosphate-buffered saline (PBS) 부유액을 원심분리하고 그 상층액을 Patho Gene-spin™ DNA/RNA Extraction Kit (iNtROn Biotechnology, Korea)를 이용하여 제조사의 추천 방법에 따라 DNA를 추출하였다.

PCV2 검출 및 유전형 분석

1차로 PCV2 양성농장 스크리닝을 위해서 PowerChek® PRRS/PCV2 Real-time PCR kit를 이용하여 제조사의 술식에 따라 RT-PCR을 실시하였다. 이후 PCV2양성이 확인된 44개의 농장에 대해서만 genotyping을 실시하였으며 총 4쌍의 primer를 사용하였다(Table 1). PCV2 검사는 추출한 nucleotides 2 μL와 각 primer 1 μL (10 pmol)를 Maxime PCR premix (iNtROn Biotechnology, Korea)에 첨가하여 진행하였다. PCV2a, PCV2b 및 PCV2d 유전형 감별을 위하여 이전에 보고된 대로 94℃에서 1분 반응시킨 다음, 94℃에 30초, 60℃에 30초 및 72℃에 1분씩 35회 반복 반응시킨 후 최종 72℃에서 10분간 반응시켰다(Kim 등, 2018). PCV2e를 검출하기 위해서는 95℃에서 5분 반응시킨 다음, 95℃에 30초, 60℃에 40초 및 72℃에 1분씩 35회 반복 반응시킨 후, 최종 72℃에서 10분간 반응시켰다(Park과 Chae, 2021). PCR이 완료되면 반응액 7 μL를 1.5% agarose gel (ethidium bromide 0.5μg/mL in DW)에 100 bp DNA Marker와 같이 TAE buffer가 함유된 전기영동 tank에 gel을 침적시킨 후 150 V/cm, 30분간 전기영동을 실시하여 자외선 하에서 특이 band 증폭 유무를 확인하였다.

Table 1 . List of primers used in this study.

Primer nameNucleotide sequence (5’-3’)PurposeProduct size (bp)Primer location (nt)Reference
PCV2ab 2NFGGTTGGAAGTAATCAATAGTGGAPCV2a-specific2771209∼1231Kwon et al, 2017a
PCV2a 2NRGGGGAACCAACAAAATCTC1467∼1485Hesse et al, 2008
PCV2ab 2NFGGTTGGAAGTAATCAATAGTGGAPCV2b-specific2771209∼1231Kwon et al, 2017a
PCV2b 2NRGGGGCTCAAACCCCCGCTC1466∼1484Hesse et al, 2008
PCV2d 2NFGGTTGGAAGTAATCGATTGTCCTPCV2d-specific3431208∼1230Kwon et al, 2017a
PCV2d 2NRTCAGAACGCCCTCCTGGAAT1531∼1550
PCV2e 2NFGGTTTGGGGGTGAAATATCGGPCV2e-specific3281251∼1271Park et al, 2020
PCV2e 2NRCTGTTGTAACCTCCACAGTCAC1557∼1578
PCV3-FTTACTTAGAGAACGGACTTGTAACGPCV3 detection649Ku et al, 2017
PCV3-RAAATGAGACACAGAGCTATATTCAG


PCV3 검출

50개 농장의 700개 시료로부터 추출한 DNA에 대하여 Maxime PCR premix (iNtROn Biotechnology, Korea)를 이용하여 PCV3를 검출하는 primer 1 μL (10 pmol)를 첨가하여 진행하였다(Table 1). PCV3의 검출하기 위한 PCR 조건은 94℃에서 2분 반응시킨 다음, 94℃에 30초, 56℃에 30초 및 72℃에 1분씩 35회 반복 반응시킨 후, 최종 72℃에서 10분간 반응시켰다(Ku 등, 2017).

결 과

PCV2 유병률 및 유전형 분포

2022년 2월부터 8월까지 축산물작업장 3개소에 출하된 50개 농장으로부터 700개 폐문림프절을 채취하여 RT-PCR을 실시하였으며 PCV2 양성이 확인된 44개 농장을 대상으로 genotyping을 실시한 결과, PCV2 유병률은 시료 수준에서는 62.3% (436/700), 농장 수준에서는 88% (44/50)로 확인되었다.

Fig. 1A에서 볼 수 있듯이 PCV2 양성인 44개 농장 중 22개 농장(44%)은 단독감염이고, 22개 농장(44%)은 2개의 유전형이 함께 혼합된 복합감염으로 나타났다(Table 2). 단독감염 농장의 경우, PCV2d가 가장 많은 부분을 차지했고(16/44, 36.4%), 그 다음은 PCV2a (3/44, 6.8%), PCV2b (2/44, 4.5%) 및 PCV2e (1/44, 2.3%) 순이었다. 복합감염 농장의 경우는 PCV2b와 PCV2d가 복합감염이 가장 많았고(5/44, 11.4%), PCV2a와 PCV2d, PCV2d와 PCV2e, PCV2a와 PCV2d 및 PCV2e (4/44, 9.1%), PCV2a와 PCV2e (3/44, 6.8%), PCV2a와 PCV2b 및 PCV2e, PCV2a와 PCV2b, PCV2d, 및 PCV2e (1/44, 2.3%) 순으로 나타났다. 또한, 시료 수준에서 살펴보면, 436개의 PCV2 양성시료 중 345개(79.1%)가 단독 감염이고, 91개(20.9%)가 복합감염으로 나타났다. 단독감염 시료 중 PCV2d가 가장 많은 부분을 차지했고(255/436, 58.5%), 그 다음은 PCV2a (40/436, 9.2%), PCV2b (28/436, 6.4%), PCV2e (22/436, 5.0%) 순이었다. 복합감염 시료의 경우는 PCV2d와 PCV2e가 가장 많았고(25/436, 5.7%), PCV2a와 PCV2d (21/436, 4.8%), PCV2a와 PCV2e (18/436, 4.1%), PCV2b와 PCV2d (18/436, 4.1%), PCV2a와 PCV2b 및 PCV2d (7/436, 1.6%), PCV2a와 PCV2d 및 PCV2e (2/436, 0.5%)순으로 나타났다(Fig. 1B, 1C, Table 3).

Table 2 . Information of tested farms and their infection status of porcine circovirus type 2 (PCV2) and PCV3.

Farm IDSample collection dateLocation of farmInfection Status of PCV2PCV2 genotypes detectedPositive rate of PCV2 (RT-PCR)Average Ct valuePositive rate of PCV3
Farm 12022.02.16WanjuMultiplebd100% (14/14)20.56±0.728.6% (4/14)
Farm 22022.02.16IksanMultipleabd100% (14/14)18.3±0.8421.4% (3/14)
Farm 32022.02.17JeongeupMultipleae100% (14/14)19.25±1.0614.3% (2/14)
Farm 42022.02.17JeongeupNegative0% (0/14)0% (0/14)
Farm 52022.02.22NamwonMultiplead100% (14/14)20.82±0.480% (0/14)
Farm 62022.02.24JeonjuSingleb100% (14/14)27.34±1.370% (0/14)
Farm 72022.02.25GimjeSingled85.7% (12/14)23.63±1.397.1% (1/14)
Farm 82022.02.25WanjuSinglea71.4% (10/14)21.22±1.110% (0/14)
Farm 92022.02.25JeongeupMultipleade92.9% (13/14)26.59±1.147.1% (1/14)
Farm 102022.03.03IksanSingled100% (14/14)21.88±0.7228.6% (4/14)
Farm 112022.03.03IksanMultiplebd100% (14/14)21.27±1.2878.6% (11/14)
Farm 122022.03.03SunchangMultiplede71.4% (10/14)29.34±1.2421.4% (3/14)
Farm 132022.03.10JangsuMultiplebd100% (14/14)23.68±1.290% (0/14)
Farm 142022.03.10JeongeupMultipleade100% (14/14)23.29±0.7614.3% (2/14)
Farm 152022.03.10JinanMultiplead100% (14/14)22.99±1.1214.3% (2/14)
Farm 162022.03.30NamwonMultiplead100% (14/14)23.72±0.7621.4% (3/14)
Farm 172022.03.30JinanSingled100% (14/14)22.58±0.727.1% (1/14)
Farm 182022.04.25ImsilMultipleade92.9% (13/14)22.37±0.9821.4% (3/14)
Farm 192022.04.25NamwonSingled85.7% (12/14)24.97±1.430% (0/14)
Farm 202022.04.25IksanMultiplede100% (14/14)25.92±0.957.1% (1/14)
Farm 212022.04.26IksanMultipleabde100% (14/14)23.71±0.6528.6% (4/14)
Farm 222022.04.26NamwonMultipleae100% (14/14)27.18±1.47.1% (1/14)
Farm 232022.04.28WanjuNegative0% (0/14)7.1% (1/14)
Farm 242022.04.28IksanSingled28.6% (4/14)25.36±2.077.1% (1/14)
Farm 252022.04.28GochangMultiplede100% (14/14)30.62±1.067.1% (1/14)
Farm 262022.05.10NamwonNegative0% (0/14)0% (0/14)
Farm 272022.05.10ImsilSingled50% (7/14)27.3±1.2521.4% (3/14)
Farm 282022.05.12NamwonSinglee21.4% (3/14)32.31±0.9814.3% (2/14)
Farm 292022.05.12NamwonSingled100% (14/14)29.78±1.330% (0/14)
Farm 302022.05.16WanjuSingled78.6% (11/14)25.27±1.287.1% (1/14)
Farm 312022.05.16GimjeMultiplead85.7% (12/14)29.2±1.110% (0/14)
Farm 322022.05.16IksanSingled78.6% (11/14)25.67±0.80% (0/14)
Farm 332022.05.24WanjuMultiplebd35.7% (5/14)29.05±2.9550% (7/14)
Farm 342022.05.24ImsilNegative0% (0/14)14.3% (2/14)
Farm 352022.05.24JeongeupSingled92.9% (13/14)24.42±1.0614.3% (2/14)
Farm 362022.05.24JeongeupNegative0% (0/14)21.4% (3/14)
Farm 372022.06.15IksanSingled57.1% (8/14)23.5±1.2721.4% (3/14)
Farm 382022.06.15MujuSingled42.9% (6/14)28.29±2.1321.4% (3/14)
Farm 392022.06.15ImsilNegative0% (0/14)28.6% (4/14)
Farm 402022.06.15GimjeSingled57.1% (8/14)25.37±2.140% (0/14)
Farm 412022.06.27WanjuSingled57.1% (8/14)29.51±1.130% (0/14)
Farm 422022.06.27IksanMultipleade50% (7/14)22.71±1.490% (0/14)
Farm 432022.06.27WanjuMultiplebd85.7% (12/14)25.29±0.8614.3% (2/14)
Farm 442022.07.14JinanMultiplede85.7% (12/14)24.28±1.0635.7% (5/14)
Farm 452022.07.14JeongeupSingled85.7% (12/14)25.9±0.8442.9% (6/14)
Farm 462022.07.14JinanSinglea28.6% (4/14)29.94±2.737.1% (1/14)
Farm 472022.07.14JeongeupSinglea85.7% (12/14)20.7±0.9221.4% (3/14)
Farm 482022.07.14GimjeSingled92.9% (13/14)24.08±1.120% (0/14)
Farm 492022.07.14IksanMultipleae64.3% (9/14)24.75±0.840% (0/14)
Farm 502022.07.21IksanSingleb14.3% (2/14)32.12±1.017.1% (1/14)


Table 3 . Prevalence and co-infection status of different genotypes of porcine circovirus type 2 and their co-infection status with PCV3 based on the PCV2-positive samples.

PCV2 genotypeSamples levelFarms levelPCV3 co-infection (samples/farms)
2a409.2%36.8%1 (1/40, 2.5%)2 (2/3, 66.7%)
2b286.4%24.5%4 (4/28, 14.3%)1 (1/2, 50.0%)
2d25558.5%1636.4%33 (33/255, 12.9%)10 (10/16, 62.5%)
2e225.0%12.3%4 (4/22, 18.2%)1 (1/1,100.0%)
2b, 2d184.1%511.4%4 (4/18, 22.2%)4 (4/5, 80.0%)
2a, 2d214.8%49.1%2 (2/21, 9.5%)2 (2/4, 50.0%)
2d, 2e255.7%49.1%6 (6/25, 24.0%)4 (4/4, 100.0%)
2a, 2e184.1%36.8%4 (4/18, 22.2%)2 (1/3, 66.7%)
2a, 2b, 2d71.6%12.3%3 (3/7, 42.9%)1 (1/1,100.0%)
2a, 2d, 2e20.5%49.1%03 (3/4, 75.0%)
2a, 2b, 2d, 2e00.0%12.3%01 (1/1,100.0%)


Figure 1. Infection status of porcine circovirus 2 (PCV2) genotypes in 50 pig farms. (A) Single or multiple infection status at the farm level, (B) infection pattern of different PCV2 genotypes at the farm level, (C) infection pattern of different PCV2 genotypes at the sample level. The small letters a, b, c, d, and e represent PCV2a, PCV2b, PCV2c, PCV2d, and PCV2e genotypes, respectively. Two or more small letters indicate co-infection of different genotypes of PCV2.

1차 PCV2 양성농장 스크리닝을 위한 RT-PCR 결과로 PCV2가 검출된 농장의 평균 Ct값은 낮게는 18.3±0.84부터 높게는 32.31±0.98로 확인되었다(Table 2). 감염된 genotype별 PCV2의 농장단위별 평균 검출 Ct값을 보면 단독감염 중 PCV2d 감염이 PCV2b나 PCV2e 단독감염에 비해 더 낮은 값을 보였고, 일반적으로 복합감염이 많이 이루어져 있을수록 검출 평균 Ct값이 낮은 것을 확인할 수 있었다(Fig. 2).

Figure 2. Distribution of Ct value generated by RT-PCR assay from porcine circovirus type 2 (PCV2)-positive samples. (A) Ct values by PCV2 infection pattern at the farm level, (B) Ct values by PCV2 infection pattern at the sample level.

PCV3 유병률 및 복합감염 상황

50개 농장의 700개 폐문림프절 시료 중에서, 35개 농장(70.0%)의 97개 시료(13.9%)가 PCV3 양성이었다. PCV2와 PCV3의 시료 및 농장 수준별 복합 감염률을 살펴보면, PCV2만 단독 감염된 경우는 시료 수준에서는 53.6% (375/700), 농장 수준에서는 26.0% (13/50)로 시료 수준에서의 복합 감염률이 더 높았고, PCV3만 단독 감염된 경우는 시료 수준에서는 5.1% (36/700), 농장 수준에서는 8.0% (4/50)였으며, PCV2와 PCV3가 복합 감염된 경우는 시료 수준에서는 8.7% (61/700)이고 농장 수준에서는 62.0% (31/50)로 농장 수준에서의 복합 감염률이 훨씬 높았다(Fig. 3).

Figure 3. Positive rate and co-infection status of porcine circovirus type 2 (PCV2) and PCV3. (A) Positive rates at the sample level. (B) Positive rates at the farm level.

고 찰

PCV2는 PMWS의 원인체로 알려져 있으며, 1991년 캐나다에서 최초로 발생 보고된 이후, 전 세계적으로 문제시되고 있는 바이러스이다(Morozov 등, 1998; Allan 등, 2000). 현재에도 양돈산업을 하는 여러 국가에 높은 발병률로 존재하고 있어 경제적으로 큰 피해를 주는 질병 중 하나이다. 현재는 써코바이러스 관련질병(Porcine circovirus associated disease; PCVAD)의 병원성과 관계되는 것으로 알려졌으며 이와 관련된 여러 가지 유전형들에 대한 변이와 유전학적 조사 또한 계속되고 있다. PCV3는 피부염이나 번식 장애가 있는 돼지에서 처음 발견된 이후로 해당 바이러스에 관한 연구가 지속되고 있으며, 한국을 포함한 세계 각국에서 보고되고 있다. 본 연구에서는 2022년 2월부터 8월에 걸쳐 전북지역 도축돈의 폐문림프절에서 PCV2의 양성률과 유전형의 분포를 확인하고 더불어 PCV3의 복합 감염률도 함께 조사하였다.

돼지는 3주령에 PCV2 백신을 접종하고 23주 후에는 PCV2 항체 수치가 감소하여 PCV2 감염에 대한 감수성이 더 상승한다. 따라서 도축돈의 림프절 검사는 양돈장에서 PCV2 감염의 좋은 지표가 된다(Park과 Chae, 2021). 반면 도축돈의 림프절 표본 추출의 단점은 농장의 임상증상 및 생산 지표를 알 수 없다는 단점이 있다. 이러한 단점을 극복하고 유병률 검사에 대한 신뢰성을 더욱 확보하기 위해서는 혈청학적 검사로 보완하기도 한다.

현재까지 5개의 PCV2 유전자형(PCV2a, 2b, 2c, 2d 및 2e)이 확인되었으며, 국내 양돈산업에 확인된 PCV2의 유전형은 PCV2a, PCV2b, PCV2d, PCV2e 등 총 4종이다. 본 연구 결과에서도 PCV2d는 국내 사육돈군에서 가장 우세한 유전형으로 가장 높은 유병률을 보이며, 새로 출현한 PCV2e는 가장 낮은 유병률을 보인다(Fig. 1). 그 중 PCV2d는 PCV2a 및 2b보다 돼지에서 더 심각한 임상증상을 유발하는 것으로 알려져 있다(Grierson 등, 2004; Guo 등, 2010). 이 연구에서는 PCV2d 유전형의 단독감염 시료에 대비하여 PCV2d를 포함한 복합감염 시료에서 RT-PCR로 더 낮은 Ct값이 검출되는 것을 확인하였다(Table 2, Fig. 2). 이는 한 그룹 내에 PCV2 유전자형이 동시에 같이 존재하고 순환한다는 것 자체가 병원성 변이에도 영향을 줄 수 있다는 것을 의미한다.

Opriessnig 등(2017)에 따르면, 현재 PCV2a에 기반을 둔 PCV2 백신은 PCV2d 바이러스혈증 등을 경감시키는 데 효과가 있으며 이러한 PCV2 백신들이 PCV2d를 효과적으로 교차 방어할 수 있다고 보고하고 있다. 그러나 최근 Kang 등(2021)의 연구 결과에 따르면, PCV2a 면역 돼지의 항혈청과 PCV2d 분리주는 서로 다른 중화능이 관찰되며, 현재 농장에서 순환하고 있는 PCV2에 대한 일관적이지 못한 PCV2 백신의 효능에 대한 문제가 야기되면서, 차세대 subunit 백신 후보로서의 PCV2d-VLPs (virus-like particles)가 써코바이러스의 다양한 유전형의 방어에 더 효과적이라고 보고하였다.

최근에 북미에서 확인된 PCV3는 번식 장애(Ku 등, 2017; Palinski 등, 2017), 심장 및 전신성 염증(Phan 등, 2016), 복합적 호흡기 질환(Shen 등, 2018) 등과 관련이 있으며, 최근에 미국, 중국, 한국에서 다양한 임상 사례에서 확인되었고(Ku 등, 2017; Kwon 등, 2017b; Palinski 등, 2017), 꾸준히 연구 및 조사가 진행되고 있다. 중국의 한 연구에 따르면 Ku 등(2017)은 PCV3 유병률을 시료 수준에서는 34.7%, 농장 수준에서 68.6%로 보고하였으며, PCV3가 뇌(73.5%), 폐(66.7%), 림프절(36.6%), 편도(66.7%), 정액(8.5%), 혈청(28.7%) 등 다양한 시료에서 검출됨을 보고하고 수직 전파의 가능성을 언급했다. 국내에서는 Kim 등(2018)의 PCV3 연구 결과에 의하면 시료 수준에서는 44.2%, 농장 수준에서는 72.6%로 검출됨을 보고하였다. 또한 Kim 등(2022b)에 따르면 triplex real-time PCR을 이용하여 PCV2, PCV3, PCV4의 유병률과 복합감염 실태를 조사하였는데, 단독감염은 각각 28.8%, 44.4%, 9.6%이고, PCV2와 PCV3의 복합감염은 12.6%, PCV2와 4의 복합감염은 3.5%, PCV3와 4의 복합감염은 5.1%이며, 3가지 타입에 모두 감염된 경우는 1.5%였다. 본 연구에서도 PCV2와 PCV3의 양성률은 각 농장으로부터 채취된 시료의 수에 의해 영향을 받기 때문에, 유병률 계산 시 편차를 최소화하기 위해서 시료 수준 및 농장 수준에서 분석하였다. 본 연구에서 도축돈의 폐문림프절을 대상으로 PCV2와 PCV3의 유병률을 조사한 결과, 시료 수준에서는 62.3% 및 13.9% 그리고 농장 수준에서는 88.0% 및 70%로 각각 확인되었고, 이 PCV2와 PCV3의 복합감염 유병률은 시료 수준에서는 8.7%, 농장 수준에서는 62.0%로 각각 나타났다. 개별 시료 수준보다 농장 수준의 유병률이 더 높은 것은 향후 PCV3 감염 혹은 PCV2와 PCV3의 복합감염이 국내 양돈농가에서 풍토적으로 발생할 가능성이 높다는 것을 의미한다. 또한 본 연구의 PCV2의 높은 유병률은 도내 양돈농가의 비육돈이 출하되기까지 전반적으로 PCV2 감염이 광범위하게 분포된 것으로 보이며, PCV3 또한 향후 농가에 발생할 가능성이 큰 상황이다.

PCV2와 PCV3의 유병률과 복합감염률에 대한 최근 국내 연구 결과와 이번 연구 결과의 차이에 대한 부분은 계절, 연령, 시료 종류, 채취 장소 등과 관련이 있다. Shen 등(2012)의 연구 결과에 따르면 모체이행항체의 감소로 인해 육성, 비육단계의 돼지들이 PCV2에 더 높은 감수성을 보이는 것으로 나타났다. 또한 Jia 등(2022)에 의하면 시료 채취 기간 중 가장 온도가 낮은 시기인 1월부터 3월에 PCV2의 유병률이 92.39%로 가장 높았고, 가장 따뜻한 시기인 7월부터 9월에 PCV2 유병률이 62.67%로 가장 낮았으며, 반면 PCV3의 유병률은 61.6%로 가장 높았다.

중국에서 설사 증상이 있는 자돈의 장 조직으로 PCV2와 PCV3와 PEDV (porcine epidemic diarrhea virus)의 복합감염률을 조사했을 때 거의 모든 개체가 복합감염 양상을 보였고, 단독감염률은 각각 2.63%, 3.95%, 6.58%로 아주 저조했다. PCV2는 PCV2-systemic disease (PCV2-SD)로 인한 장관 질병과 연관이 있으며, PCV3의 경우는 병원성은 밝혀지지 않았지만, 최근 설사 증상을 보이는 이유자돈 시료에서도 검출되었다는 보고가 있다(Qi 등, 2019). 이처럼 PCV2와 PCV3의 복합감염은 호흡기 질병뿐만 아니라 다른 돼지 질병의 발생과도 관련이 있다. 그러므로 본 연구에서 대상 범위가 2가지의 돼지써코바이러스의 유병률과 복합감염에 한정되어 조사하였더라도, 향후 PRRSV (Porcine reproductive and respiratory syndrome virus)나 PEDV와 같은 다른 병원체와의 복합감염에 관한 연구도 필요하다.

Woźniak 등(2019)의 연구 결과에 의하면 PCV2 백신 접종 유무와 PCV2의 감염 수준은 PCV3 감염에 영향을 미치지 않는다. 이는 PCV2의 백신 접종을 하지 않고, PCV2의 감염 수준이 높다고 해도 PCV3 감염을 증가시키지는 않는다는 의미이다. 또한 이는 PCV3 감염이 이루어지지 않도록 별도의 예방 대책이 필요하다는 것을 의미한다. 그러므로 PCV2의 신규 백신을 개발할 때는 PCV2a 기반의 백신을 PCV2d로의 업데이트와 더불어 PCV3를 같이 방어할 수 있는 서브 유닛 백신 개발도 필요하다고 생각한다.

결 론

본 연구에서는 50개 양돈장의 도축돈 700 마리에서 폐문림프절을 채취하여 Real-time PCR과 genotyping을 통해 PCV2와 PCV3의 유병률과 PCV2의 유전형 분포를 조사하였다. 그 결과, 44개 농장 436두에서 PCV2 DNA가 확인되어 시료 수준에서 62.3%, 농장 수준에서 88%의 양성률을 보였다.

PCV2 양성인 44개 농장 중 22개 농장은 1개 유전형이 단독감염되었으며, 22개 농장은 2개 이상 유전형이 복합감염된 것으로 나타났다. 단독감염 농장의 경우, PCV2d의 시료 및 농장 수준 양성률이 각각 36.4% 및 58.5%로 가장 높았으며, PCV2e가 가장 낮은 양성률을 보였다.

PCV2 양성 농장 검출을 위해 실시한 RT-PCR 결과로, 농장의 평균 Ct값은 PCV2d 단독감염이 PCV2b나 PCV2e 단독감염에 비해 더 낮으며 일반적으로 단독감염보다 복합감염이 더 낮은 Ct값을 나타냈다.

PCV3는 50개 농장 700개 폐문림프절 시료 중에서, 35개 농장(70.0%)의 97개 시료(13.9%)에서 검출되었다. PCV2와의 복합감염 상황을 조사한 결과, 시료 수준에서 8.7% (61/700) 및 농장 수준에서 62.0% (31/50)로 확인되어 농장 수준에서의 복합감염 비율이 훨씬 높았다. 이는 향후 농장 내 PCV3의 감염 또는 PCV2와의 복합감염이 더욱 상재화 될 가능성이 있다는 것을 의미한다.

한국 농장의 높은 PCV2 및 PCV3 감염률을 고려할 때 육성·비육돈 및 출하돈에 대한 지속적인 유병률 검사는 물론 다양한 유전형 발생에 대한 변이 감시와 함께 다른 돼지 질병과의 복합감염에 대한 연구도 필요하다고 생각된다.

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

Fig 1.

Figure 1.Infection status of porcine circovirus 2 (PCV2) genotypes in 50 pig farms. (A) Single or multiple infection status at the farm level, (B) infection pattern of different PCV2 genotypes at the farm level, (C) infection pattern of different PCV2 genotypes at the sample level. The small letters a, b, c, d, and e represent PCV2a, PCV2b, PCV2c, PCV2d, and PCV2e genotypes, respectively. Two or more small letters indicate co-infection of different genotypes of PCV2.
Korean Journal of Veterinary Service 2023; 46: 315-324https://doi.org/10.7853/kjvs.2023.46.4.315

Fig 2.

Figure 2.Distribution of Ct value generated by RT-PCR assay from porcine circovirus type 2 (PCV2)-positive samples. (A) Ct values by PCV2 infection pattern at the farm level, (B) Ct values by PCV2 infection pattern at the sample level.
Korean Journal of Veterinary Service 2023; 46: 315-324https://doi.org/10.7853/kjvs.2023.46.4.315

Fig 3.

Figure 3.Positive rate and co-infection status of porcine circovirus type 2 (PCV2) and PCV3. (A) Positive rates at the sample level. (B) Positive rates at the farm level.
Korean Journal of Veterinary Service 2023; 46: 315-324https://doi.org/10.7853/kjvs.2023.46.4.315

Table 1 . List of primers used in this study.

Primer nameNucleotide sequence (5’-3’)PurposeProduct size (bp)Primer location (nt)Reference
PCV2ab 2NFGGTTGGAAGTAATCAATAGTGGAPCV2a-specific2771209∼1231Kwon et al, 2017a
PCV2a 2NRGGGGAACCAACAAAATCTC1467∼1485Hesse et al, 2008
PCV2ab 2NFGGTTGGAAGTAATCAATAGTGGAPCV2b-specific2771209∼1231Kwon et al, 2017a
PCV2b 2NRGGGGCTCAAACCCCCGCTC1466∼1484Hesse et al, 2008
PCV2d 2NFGGTTGGAAGTAATCGATTGTCCTPCV2d-specific3431208∼1230Kwon et al, 2017a
PCV2d 2NRTCAGAACGCCCTCCTGGAAT1531∼1550
PCV2e 2NFGGTTTGGGGGTGAAATATCGGPCV2e-specific3281251∼1271Park et al, 2020
PCV2e 2NRCTGTTGTAACCTCCACAGTCAC1557∼1578
PCV3-FTTACTTAGAGAACGGACTTGTAACGPCV3 detection649Ku et al, 2017
PCV3-RAAATGAGACACAGAGCTATATTCAG

Table 2 . Information of tested farms and their infection status of porcine circovirus type 2 (PCV2) and PCV3.

Farm IDSample collection dateLocation of farmInfection Status of PCV2PCV2 genotypes detectedPositive rate of PCV2 (RT-PCR)Average Ct valuePositive rate of PCV3
Farm 12022.02.16WanjuMultiplebd100% (14/14)20.56±0.728.6% (4/14)
Farm 22022.02.16IksanMultipleabd100% (14/14)18.3±0.8421.4% (3/14)
Farm 32022.02.17JeongeupMultipleae100% (14/14)19.25±1.0614.3% (2/14)
Farm 42022.02.17JeongeupNegative0% (0/14)0% (0/14)
Farm 52022.02.22NamwonMultiplead100% (14/14)20.82±0.480% (0/14)
Farm 62022.02.24JeonjuSingleb100% (14/14)27.34±1.370% (0/14)
Farm 72022.02.25GimjeSingled85.7% (12/14)23.63±1.397.1% (1/14)
Farm 82022.02.25WanjuSinglea71.4% (10/14)21.22±1.110% (0/14)
Farm 92022.02.25JeongeupMultipleade92.9% (13/14)26.59±1.147.1% (1/14)
Farm 102022.03.03IksanSingled100% (14/14)21.88±0.7228.6% (4/14)
Farm 112022.03.03IksanMultiplebd100% (14/14)21.27±1.2878.6% (11/14)
Farm 122022.03.03SunchangMultiplede71.4% (10/14)29.34±1.2421.4% (3/14)
Farm 132022.03.10JangsuMultiplebd100% (14/14)23.68±1.290% (0/14)
Farm 142022.03.10JeongeupMultipleade100% (14/14)23.29±0.7614.3% (2/14)
Farm 152022.03.10JinanMultiplead100% (14/14)22.99±1.1214.3% (2/14)
Farm 162022.03.30NamwonMultiplead100% (14/14)23.72±0.7621.4% (3/14)
Farm 172022.03.30JinanSingled100% (14/14)22.58±0.727.1% (1/14)
Farm 182022.04.25ImsilMultipleade92.9% (13/14)22.37±0.9821.4% (3/14)
Farm 192022.04.25NamwonSingled85.7% (12/14)24.97±1.430% (0/14)
Farm 202022.04.25IksanMultiplede100% (14/14)25.92±0.957.1% (1/14)
Farm 212022.04.26IksanMultipleabde100% (14/14)23.71±0.6528.6% (4/14)
Farm 222022.04.26NamwonMultipleae100% (14/14)27.18±1.47.1% (1/14)
Farm 232022.04.28WanjuNegative0% (0/14)7.1% (1/14)
Farm 242022.04.28IksanSingled28.6% (4/14)25.36±2.077.1% (1/14)
Farm 252022.04.28GochangMultiplede100% (14/14)30.62±1.067.1% (1/14)
Farm 262022.05.10NamwonNegative0% (0/14)0% (0/14)
Farm 272022.05.10ImsilSingled50% (7/14)27.3±1.2521.4% (3/14)
Farm 282022.05.12NamwonSinglee21.4% (3/14)32.31±0.9814.3% (2/14)
Farm 292022.05.12NamwonSingled100% (14/14)29.78±1.330% (0/14)
Farm 302022.05.16WanjuSingled78.6% (11/14)25.27±1.287.1% (1/14)
Farm 312022.05.16GimjeMultiplead85.7% (12/14)29.2±1.110% (0/14)
Farm 322022.05.16IksanSingled78.6% (11/14)25.67±0.80% (0/14)
Farm 332022.05.24WanjuMultiplebd35.7% (5/14)29.05±2.9550% (7/14)
Farm 342022.05.24ImsilNegative0% (0/14)14.3% (2/14)
Farm 352022.05.24JeongeupSingled92.9% (13/14)24.42±1.0614.3% (2/14)
Farm 362022.05.24JeongeupNegative0% (0/14)21.4% (3/14)
Farm 372022.06.15IksanSingled57.1% (8/14)23.5±1.2721.4% (3/14)
Farm 382022.06.15MujuSingled42.9% (6/14)28.29±2.1321.4% (3/14)
Farm 392022.06.15ImsilNegative0% (0/14)28.6% (4/14)
Farm 402022.06.15GimjeSingled57.1% (8/14)25.37±2.140% (0/14)
Farm 412022.06.27WanjuSingled57.1% (8/14)29.51±1.130% (0/14)
Farm 422022.06.27IksanMultipleade50% (7/14)22.71±1.490% (0/14)
Farm 432022.06.27WanjuMultiplebd85.7% (12/14)25.29±0.8614.3% (2/14)
Farm 442022.07.14JinanMultiplede85.7% (12/14)24.28±1.0635.7% (5/14)
Farm 452022.07.14JeongeupSingled85.7% (12/14)25.9±0.8442.9% (6/14)
Farm 462022.07.14JinanSinglea28.6% (4/14)29.94±2.737.1% (1/14)
Farm 472022.07.14JeongeupSinglea85.7% (12/14)20.7±0.9221.4% (3/14)
Farm 482022.07.14GimjeSingled92.9% (13/14)24.08±1.120% (0/14)
Farm 492022.07.14IksanMultipleae64.3% (9/14)24.75±0.840% (0/14)
Farm 502022.07.21IksanSingleb14.3% (2/14)32.12±1.017.1% (1/14)

Table 3 . Prevalence and co-infection status of different genotypes of porcine circovirus type 2 and their co-infection status with PCV3 based on the PCV2-positive samples.

PCV2 genotypeSamples levelFarms levelPCV3 co-infection (samples/farms)
2a409.2%36.8%1 (1/40, 2.5%)2 (2/3, 66.7%)
2b286.4%24.5%4 (4/28, 14.3%)1 (1/2, 50.0%)
2d25558.5%1636.4%33 (33/255, 12.9%)10 (10/16, 62.5%)
2e225.0%12.3%4 (4/22, 18.2%)1 (1/1,100.0%)
2b, 2d184.1%511.4%4 (4/18, 22.2%)4 (4/5, 80.0%)
2a, 2d214.8%49.1%2 (2/21, 9.5%)2 (2/4, 50.0%)
2d, 2e255.7%49.1%6 (6/25, 24.0%)4 (4/4, 100.0%)
2a, 2e184.1%36.8%4 (4/18, 22.2%)2 (1/3, 66.7%)
2a, 2b, 2d71.6%12.3%3 (3/7, 42.9%)1 (1/1,100.0%)
2a, 2d, 2e20.5%49.1%03 (3/4, 75.0%)
2a, 2b, 2d, 2e00.0%12.3%01 (1/1,100.0%)

References

  1. Allan G and Ellis J. 2000. Porcine circoviruses: A review. J Vet Diagn Invest 12:3-14.
    Pubmed CrossRef
  2. Allan G, Krakowka S, Charreyre C. 2012. Discovery and evolving history of two genetically related but phenotypically different viruses, porcine circoviruses 1 and 2. Virus Res 164:4-9.
    Pubmed CrossRef
  3. Chae C. 2004. Postweaning multisystemic wasting syndrome: a review of aetiology, diagnosis and pathology. Vet J 168:41-49.
    Pubmed CrossRef
  4. Chae C. 2005. A review of porcine circovirus 2-associated syndromes and diseases. Vet J 169:326-336.
    Pubmed CrossRef
  5. Chae C. 2012. Porcine circovirus type 2 and its associated diseases in Korea. Virus Res 164:107-113.
    Pubmed CrossRef
  6. Davies B, Wang X, Dvorak CM, Murtaugh MP. 2016. Diagnostic phylogenetics reveals a new porcine circovirus 2 cluster. Virus Res 217:32-37.
    Pubmed CrossRef
  7. Dupont K, Nielsen E, Larsen L. 2008. Genomic analysis of PCV2 isolates from Danish archives and a current PMWS case-control study supports a shift in genotypes with time. Vet Microbiol 128:56-64.
    Pubmed CrossRef
  8. Fraile L, Sibila M, Nofrarias M, Lopez-Jimenez R, Huerta E, Llorens A, Lopez-Soria S, Segales J. 2012. Effect of sow and piglet porcine circovirus type 2 (PCV2) vaccination on piglet mortality, viraemia, antibody titre and production parameters. Vet Microbiol 161:229-34.
    Pubmed CrossRef
  9. Grau-Roma L, Segales J. 2011. Recent advances in the epidemiology, diagnosis and control of diseases caused by porcine circovirus type 2. Vet J 187:23-32.
    Pubmed CrossRef
  10. Grierson SS, King DP, Sandvik T, Hicks D, Spencer Y, Banks M. 2004. Detection and genetic typing of type 2 porcine circoviruses in archived pig tissues from the UK. Arch Virol 149:1171-1183.
    Pubmed CrossRef
  11. Guo LL, Lu YH, Wei YW, Liu CM. 2010. Porcine circovirus type 2 (PCV2): Genetic variation and newly emerging genotypes in China. Virology 7:273-284.
    Pubmed KoreaMed CrossRef
  12. Hesse R, Rowland RR. 2008. Evidence for recombination between PCV2a and PCV2b in the field. Virus Res 132:201-207.
    Pubmed CrossRef
  13. Jia Y, Zhu Q, Xu T, Chen X, Li H, Ma M, Zhang Y, Chen H. 2022. Detection and genetic characteristics of porcine circovirus type 2 and 3 in Henan province of China. Mol Cell Probes 61:101790.
    Pubmed CrossRef
  14. Kang SJ, Bae SM, Lee HJ, Jeong YJ, Lee MA, You SH, Lee HS, Hyun BH, Cha SH. 2021. Porcine circovirus (PCV) genotype 2d-based virus-like particles (VLPs) Induced broad cross-neutralizing antibodies against diverse genotypes and provided protection in dual-challenge infection of a PCV2d virus and a type 1 porcine reproductive and respiratory syndrome virus (PRRSV). Pathogens 10:1145.
    Pubmed KoreaMed CrossRef
  15. Klaumann F, Correa-Fiz F, Sibila M, Segalés J. 2019. Infection dynamics of porcine circovirus type 3 in longitudinally sampled pigs from four Spanish farms. Vet Rec 184:619-619.
    Pubmed CrossRef
  16. Kim HR, Lim DR, Chae HG, Park JY, Kim SH, Lee KK, Lee C, Park CK. 2020. Advanced target-specific probe-based real-time loop-mediated isothermal amplification assay for the rapid and specific detection of porcine circovirus 3. Transbound Emerg Dis 67:2336-2344.
    Pubmed CrossRef
  17. Kim HR, Park J, Park JH, Kim JM, Baek KS, Kim DY, Park CK. 2022a. Development of a real-time polymerase chain reaction assay for reliable detection of a novel porcine circovirus 4 with an endogenous internal positive control. Korean J Vet Serv 45:1-11.
    CrossRef
  18. Kim HR, Park JH, Kim WI, Park CK. 2022b. Prevalence and co-infection status of three pathogenic porcine circoviruses (PCV2, PCV3, and PCV4) by a newly established triplex real-time polymerase chain reaction assay. Korean J Vet Serv 45:87-99.
    CrossRef
  19. Kim J, Chae C. 2003. Association of porcine circovirus 2 with porcine respiratory disease complex. Vet J. 166:251-256.
    Pubmed CrossRef
  20. Kim SC, Nazki S, Kwon S, Juhng JH, Mun KH, Kim WI. 2018. The prevalence and genetic characteristics of porcine circovirus type 2 and 3 in Korea. BMC Vet Res 14:1-9.
    Pubmed KoreaMed CrossRef
  21. Kwon T, Lee DU, Yoo SJ, Je SH, Lyoo YS. 2017a. Genotypic diversity of porcine circovirus type 2 (PCV2) and genotype shift to PCV2d in Korean pig population. Virus Res 228:24-29.
    Pubmed CrossRef
  22. Kwon T, Yoo SJ, Lyoo YS. 2017b. Prevalence of novel porcine circovirus 3 in Korean pig populations. Vet Microbiol 207:178-180.
    Pubmed CrossRef
  23. Ku X, Chen F, Li P, Wang Y, Yu X, Fan S, Qian P, He Q. 2017. Identification and genetic characterization of porcine circovirus type 3 in China. Transbound Emerg Dis 64:703-708.
    Pubmed KoreaMed CrossRef
  24. Morozov I, Sirinarumitr T, Sorden SD, Halbur P, Morgan M, Paul PS. 1998. Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome. J Clin Microbiol 36:2535-2541.
    Pubmed KoreaMed CrossRef
  25. Oliver-Ferrando S, Segales J, Lopez-Soria S, Callen A, Merdy O, Sibila M. 2016. Evaluation of natural porcine circovirus type 2 (PCV2) subclinical infection and seroconversion dynamics in piglets vaccinated at different ages. Vet Res 47:121.
    Pubmed KoreaMed CrossRef
  26. Olvera A, Segales J. 2007. Molecular evolution of porcine circovirus type 2 genomes: phylogeny and clonality. Virology. 357:175-185.
    Pubmed CrossRef
  27. Opriessnig T, Xiao CT, Halbur PG, Gerber PF, Meng XJ. 2017. A commercial porcine circovirus (PCV) type 2a-based vaccine reduces PCV2d viremia and shedding and prevents PCV2d transmission to naive pigs under experimental conditions. Vaccine 35:248-54.
    Pubmed KoreaMed CrossRef
  28. Park KH, Oh T, Cho H, Chae C. 2020. The first isolation of porcine circovirus type 2e from a Korean pig. Arch Virol 165:2927-2930.
    Pubmed CrossRef
  29. Park KH and Chae CH. 2021. The prevalence of porcine circovirus type 2e (PCV2e) in Korean slaughter pig lymph nodes when compared with other PCV2 genotypes. Transbound Emerg Dis 68:3043-3047.
    Pubmed CrossRef
  30. Palinski R, Pineyro P, Shang PC, Yuan FF, Guo R, Hause BM. 2017. A novel porcine circovirus distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure. J Virol 91:e01879.
    Pubmed KoreaMed CrossRef
  31. Phan T, Giannitti F, Rossow S, Marthaler D, Knutson T, Li L, Deng X, Resende T, Delwart E. 2016. Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation. Virol J 13:1-8.
    Pubmed KoreaMed CrossRef
  32. Rosell C, Segales J, Ramos-Vara JA, Folch JM, Rodriguez-Arrioja GM, Duran CO, Balasch M, Domingo M. 2000. Identification of porcine circovirus in tissues of pigs with porcine dermatitis and nephropathy syndrome. Vet Rec 146:40-43.
    Pubmed CrossRef
  33. Saraiva GL, Vidigal PMP, Assao VS, Fajardo MLM, Loreto ANS, Fietto JLR, Bressan GC, Lobato ZIP, Silva-Júnior A. 2019. Retrospective detection and genetic characterization of porcine circovirus 3 (PCV3) strains identified between 2006 and 2007 in Brazil. Viruses 11:201.
    Pubmed KoreaMed CrossRef
  34. Shen H, Liu X, Zhang P, Wang L, Liu Y, Zhang L, Song C. 2018. Genome characterization of a porcine circovirus type 3 in South China. Transbound Emerg Dis 65:264-266.
    Pubmed CrossRef
  35. Shen HG, Loiacono CM, Opriessnig T. 2012. Age-dependent susceptibility to porcine circovirus type 2 infections is likely associated with declining levels of maternal antibodies. J Swine Health Prod 20:17-24.
  36. Qi S, Su M, Guo D, Li C, Wei S, Sun D. 2019. Molecular detection and phylogenetic analysis of porcine circovirus type 3 in 21 Provinces of China during 2015-2017. Transbound Emerg Dis 66:1004-1015.
    Pubmed CrossRef
  37. Stadejek T, Wozniak A, Biernacka K. 2017. First detection of porcine circovirus type 3 on commercial pig farms in Poland. Transbound Emerg Dis 64:1350-1353.
    Pubmed CrossRef
  38. Sun W, Du Q, Han Z, Bi J, Lan T, Zheng M. 2021. Detection and genetic characterization of porcine circovirus 4 (PCV4) in Guangxi, China. Gene 773:145384.
    Pubmed CrossRef
  39. Woźniak A, Miłek D, Stadejek T. 2019. Does porcine circovirus type 3 (PCV3) interfere with porcine circovirus type 2 (PCV2) vaccine efficacy? Transbound Emerg Dis 66:1454-1461.
    Pubmed CrossRef
  40. Xiao CT, Opriessnig T. 2015. Global molecular genetic analysis of porcine circovirus type 2 (PCV2) sequences confirms the presence of four main PCV2 genotypes and reveals a rapid increase of PCV2d. J Gen Virol 96:1830-1841.
    Pubmed CrossRef
KJVS
Mar 30, 2024 Vol.47 No.1, pp. 1~7

Stats or Metrics

Share this article on

  • line

Related articles in KJVS

Korean Journal of
Veterinary Service

eISSN 2287-7630
pISSN 1225-6552
qr-code Download