Korean Journal of
Veterinary Service

Earth’s climate is constantly changing. Currently, the Earth is in a warming phase for about three centuries, preceded by an earlier Little Ice Age and a Medieval Warm Period (Reiter, 2001). Although these changes have occurred naturally, recent global warming has been attributed to human activities, with the average global temperature rising about 0.7℃ over the past 100 years. Many researchers estimate that global average temperatures will increase by 1∼3.5℃ by the end of the 21st century. It is the result of a variety of human activities, including excessive fossil fuel use, agricultural land growth, deforestation, and industrialization (Yi et al, 2014). This increase in temperature causes not only regional climate change but also global change, which in turn affects various physical and biological systems.

There are various problems caused by global warming, such as inundation of some islands due to sea level rise, ecosystem disturbance, and endangered species, but among them, the spread of diseases due to the spread of insect vectors due to climate change is a major problem (Patz et al, 2005). Insect vectors are insects that can be carriers of zoonotic diseases, such as mosquitoes, ticks, flies, and fleas. These insect vectors breed in areas suitable for life cycles and climatic factors are most suitable. Increases in temperature generally increase the proliferation of insect vectors and shorten the incubation period of viruses in the body, thereby increasing viral amplification. As a result, the probability of disease transmission and occurrence is increased (Wilson et al, 2017). Therefore, climate and environmental changes caused by global warming cause mosquitoes to occur and blood-sucking activities appear not only in summer but also in winter, and increase damage caused by mosquitoes (Yeom, 2017). Infectious diseases transmitted by these mosquitoes include malaria, Japanese encephalitis, dengue fever, and West Nile fever.

Although human has continuously tried to block and eradicate mosquito-borne diseases such as malaria through the development of preventive vaccines and environmental improvement, it is still threatened by various infectious diseases transmitted through mosquitoes. In Korea, infectious diseases such as Japanese encephalitis and malaria were prevalent in the past, but they have greatly decreased since the 1970s through continuous efforts. Malaria was once eradicated, and Japanese encephalitis preventive vaccines were introduced in 1971, resulting in a sharp decline in the number of patients. However, since 1993, a re-emergence of malaria has occurred every year, and this pattern is also seen in Japanese encephalitis (CDC, 2021).

In addition, with the increase in overseas travelers, mosquito-borne infectious diseases imported from abroad are increasing, and dengue fever is rapidly spreading. Dengue fever is an infectious disease transmitted by the bite of Aedes mosquitoes infected with the dengue virus, which exposes more than half of the population to the risk of dengue fever and causes up to 400 million patients every year (Mangold and Reynolds, 2013). There are five serotypes of dengue virus, and since immunity is developed only for each serotype, re-infection with another serotype is possible. The vectors of dengue fever are Aedes aegypti and Aedes albopictus, which inhabit all regions of Korea. If the number of imported cases continues to increase and the climatic conditions change, there is a high possibility of native infection in Korea, and such cases have already appeared in France and Japan (Kutsuna et al, 2015; Quam et al, 2016; Succo et al, 2016).

The reason why mosquito-borne infectious diseases are increasing and diversifying is because the number of imported cases is increasing along with changes in vector ecosystems, urbanization, and herd immunity due to global climate change. Therefore, it is considered necessary to investigate the current distribution status of domestic mosquitoes and pathogens according to climate change. Mosquitoes, which are the main carriers of vector-transmitted infectious diseases, have higher blood-sucking habits in livestock than in humans. Considering these characteristics, this study aims to contribute to blocking the transmission of mosquito-borne infectious diseases by investigating the distribution of mosquitoes and the actual status of zoonosis infection in slaughterhouses, which are livestock gathering facilities in large cities.

Mosquito collection and classification identification

Mosquitoes were collected once a month from one slaughterhouse (3 locations: cow lairage, pig lairage, cow by-product processing room) in the Daejeon area for 9 months from March to November in 2021. Mosquitoes were collected for 48 hours after installing a pyloric lamp (Blackhole plus, Biotrap Co., Korea). The collected mosquitoes were morphologically classified and identified using a stereoscopic microscope (SZ61, Olympus Co., Tokyo, Japan). After identification, a maximum of 30 mosquitoes were placed in a 2 mL tube for grinding containing 2 mm zirconia beads and stored at −70℃ until pathogen testing.

Gene extraction

1 mL of sterilized PBS (phosphate buffer saline) was put in a grinding tube, and then ground twice for 20 seconds at 5,000 rpm using an automatic homogenizer (Precellys 24 tissue homogenizer, Bertin Technologies Co., Bretonneux, France), and then left in the refrigerator. Thereafter, the homogenizer tube was centrifuged at 13,000 rpm for 1 minute in a refrigerated centrifuge, and the gene was extracted using the TANBead Nucleic Acid Extraction Kit (Taiwan Advanced Nanotech Inc., Taiwan) according to the method provided by the manufacturer.

Pathogen test method

Nested PCR and real-time PCR were performed to confirm the infection of the collected mosquitoes with pathogens (malaria, chikungunia, 5 types of flavivirus: dengue fever, West Nile fever, Japanese encephalitis, Zika virus, and yellow fever). Primer compositions for detecting malaria and flavivirus genes are shown in Table 1.

Table 1 . Information of PCR primers.

Step	Primer	Species	Sequence (5’→3’)	Diagnostic size
1st PCR	rPLU5	Plasmodium species	CCTGTTGTTGCCTTAAACTTC	1,100 bp
	rPLU6		TTAAAATTGTTGCAGTTAAAACG
2nd PCR	rVIV1	Plasmodium vivax	CGCTTCTAGCTTAATCCACATAACTGATAC	120 bp
	rVIV2		ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA
Flavivirus PCR	PFlav-fAAR	Flavivirus	TACAACATGATGGGAAAGAGAGAGAARAA	265 bp
	PFlav-rKR		GTGTCCCAKCCRGCTGTGTCATC
Chikungunya virus PCR	10294f	Chikungunya virus	ACGCAATTGAGCGAAGCACAT	300 bp
	10573r		AAATTGTCCTGGTCTTCCTG

Nested PCR

The rPLU5/rPLU6 genus-specific primer set was used to detect the PLU gene of malaria (Plasmodium sp.), and the rVIV1/rVIV2 species-specific primer set was used to detect the VIV gene of Plasmodium vivax. For gene detection, 250 mM deoxynucleotide triphosphate (R0191, Fermentas Co., Massachusetts, US), 10X PCR buffer (500 mM KCl, 100 mM Tris-HCl [pH 8.3], 20 mM MgCl₂), 2 U/μL Taq DNA polymerase (SB38, Fermentas Co., Massachusetts, US) and PCR reaction solution consisting of 5 pmol of each primer set were requested to Bioneer Co. and freeze-dried to prepare a PreMix tube for use. 5 μL of template DNA was mixed in the tube and 7 μL of 3rd deionized distilled water was added to make the total amount to 20 μL. Nested PCR was performed using Veriti Thermal Cycler (Applied Biosystems Co., Massachusetts, US) by referring to the condition from the previous study (Genc et al, 2010). The positive control was obtained from the Centers for Disease Control and diluted 10⁻³ times.

Real-time RT-PCR

AccuPower Customized Dual-HotStart RT-qPCR PreMix kit (Bioneer Co., Daejeon, Korea) was used to detect chikungunya virus genes. According to the manufacturer’s instructions, 5 μL of template DNA was added to prepare a PCR reaction solution with a final volume of 20 μL. The probe has FAM bound to the receptor dye and BHQ1 bound to the quancher dye. Real-time RT-PCR was performed using 7500 Fast Real-Time PCR System (Applied Biosystems Co., Massachusetts, US) according to manufacturer’s instructions.

PFlav-fAAR and PFlav-rKR primers targeting the NS5 region were used to detect flavivirus genes. The reaction mixture comprised 25 μL solution including 0.25 μL of vero enzyme mix, 12.5 μL of 1-step qPCR SYBR ROX mix, 1.25 μL of RT enhancer, 2.5 μL of 1uM primer mix, 3.5 μL of RNase-free water, and 5 μL of RNA. Real-time PT-PCR was performed using 7500 Fast Real-Time PCR System by referring to the condition from the previous study (Yang et al, 2010). After real-time PCR, melt curve analysis was performed to determine whether the fluorescence signal seen in the amplification plot analysis was a virus-specific product, a primer dimer, or a non-specific product (Patel et al, 2013). For positive controls, Japanese encephalitis virus, westnile virus, and zika virus were received from the Animal and Plant Quarantine Agency in Korea.

PCR and sequencing

For sequencing analysis, PCR was performed with real-time RT-PCR products. The PCR primer is the same as the real-time RT-PCR primer. The reaction mixture comprised 50 μL solution including 1X optimized DyNAzyme EXT buffer 5 μL, 200 uM dNTP mix 1 μL, 0.5uM Primer mix 2.5 μL, DyNAzyme EXT DNA polymerase 1 μL, real-time RT-PCR product 1 μL and 39.5 μL of RNase-free water. The thermocycling profile for PCR was 94℃ for 2 min, followed by 35 cycles of 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 30 sec with final extension at 72℃ for 5 min using Veriti Thermal Cycler.

The amplified product (265 bp) was confirmed using an automated electrophoresis system (QIAxcel advanced system, QIAGEN Co., Hilden, Germany). The amplification product was sent to Bioneer Co. (Daejeon, Korea) for gene sequencing, and the gene sequencing was analyzed using NCBI-BLAST.

Distribution status of mosquitoes

Meteorological conditions by locations were averaged from data obtained from the slaughterhouse. The meteorological conditions from March to November are shown in Table 2. A total of 820 mosquitoes belonging to 5 genera and 8 species were collected from 3 locations in the slaughterhouse in the Daejeon for 9 months from March to November 2021. Among the 8 species, there were two species of Anopheles, two species of Culex, single species of Masonia, two species of Aedes and single species of Armigeres. Among the collected mosquitoes, Aedes vexans nipponii was the dominant species with 38.9%, and Culex pipiens pallens was the second most collected species with 35.93%. After that, Anopheles sinensis showed 13.41% and Armigeres subalbatus 5.93%, and the rest of the species showed a low rate (Table 3).

Table 2 . Meteorological condition in the slaughterhouse from March to November in 2021.

Location		Mar	Apr	May	Jun	Jul	Aug	Sep	Oct	Nov
Cow lairage	a	21	17.2	21.9	25.7	27.8	36.7	27.7	17.1	15.7
	b	46	41	41	68	78	46	53	45	52
Pig lairage	a	21.3	18.5	21	26.7	27.3	26.9	28.5	20.2	13.8
	b	54	47	51	69	79	87	57	47	84.6
Cow by-product processing room	a	21.3	16.1	21.9	25.3	29.3	31	27.2	18.2	12.8
	b	41	44	46	70	75	76	61	46	63
Exterior		8.0∼18.4	3.2∼17.3	11.1∼25.7	20.9∼30.5	23.4∼31.0	22.6∼32.0	20.1∼28.5	4.6∼16.2	1.5∼16.8

a, temperature (℃); b, humidity (%)..

Table 3 . Seasonal and species prevalence of mosquitoes collected by black light trap.

	Mar	Apr	May	Jun	Jul	Aug	Sep	Oct	Nov	Total*
Anopheles sinensis	1 (0.12)	-	-	3 (0.37)	48 (5.85)	17 (2.07)	41 (5.0)	-	-	110 (13.41)
Anopheles koreicus	2 (0.24)	-	1 (0.12)	-	9 (1.1)	-	-	1 (0.12)	-	13 (1.59)
Culex pipiens pallens	1 (0.12)	5 (0.61)	12 (1.46)	51 (6.22)	17 (2.07)	7 (0.85)	185 (22.56)	5 (0.61)	12 (1.46)	295 (35.93)
Culex inatomii	1 (0.12)	-	-	-	-	1 (0.12)	15 (1.83)	2 (0.24)	-	19 (2.32)
Mansonia uniformis	-	-	-	14 (1.71)	-	-	-	-	-	14 (1.71)
Aedes albopictus	-	-	-	-	-	-	1 (0.12)	-	-	1 (0.12)
Aedes vexans nipponii	-	-	1 (0.12)	223 (27.2)	29 (3.54)	12 (1.46)	54 (6.59)	-	-	319 (38.9)
Armigeres subalbatus	-	-	5 (0.61)	38 (4.63)	2 (0.24)	1 (0.12)	3 (0.37)	-	-	49 (5.93)
Total	5 (0.61)	5 (0.61)	19 (2.32)	329 (40.12)	105 (12.8)	38 (4.63)	299 (36.46)	8 (0.93)	12 (1.46)	820 (100)

*Percentage for total collected in each month..

By month, the largest number of mosquitoes was collected in June with 329 (40.12%), followed by September with 299 (36.46%) and July with 105 (12.8%) (Table 3).

Comparing the number of mosquitoes collected by location, 340 (41.46%) were collected from the cow by-products processing room, 323 (39.39%) from the cattle lairage, and 157 (19.15%) from the pig lairage (Table 4).

Table 4 . Seasonal and locational prevalence of mosquitoes collected by black light trap.

Location	Mar	Apr	May	Jun	Jul	Aug	Sep	Oct	Nov	Total*
Cow lairage	1 (0.12)	2 (0.24)	15 (1.83)	217 (26.46)	9 (1.1)	1 (0.12)	72 (8.78)	1 (0.12)	5 (0.61)	323 (39.39)
Pig lairage	3 (0.37)	2 (0.24)	-	67 (8.17)	25 (3.05)	2 (0.24)	54 (6.59)	2 (0.24)	2 (0.24)	157 (19.15)
Cow by-product processing room	1 (0.12)	1 (0.12)	4 (0.49)	45 (5.49)	71 (8.66)	35 (4.27)	173 (21.1)	5 (0.61)	5 (0.61)	340 (41.46)
Total	5 (0.61)	5 (0.61)	19 (2.32)	329 (40.12)	105 (12.8)	38 (4.63)	299 (36.46)	8 (0.98)	12 (1.46)	820 (100)

*Percentage for total collected in each month..

Pathogen test and identification

After 820 collected mosquitoes were classified by month, collection site, and mosquito species, they were grouped into 72 pools to check whether they contained malaria, chikungunia, or flavivirus. Malaria and chikungunia were not detected, but 7 pools of flavivirus were detected.

As a result of sequencing confirmation, 3 pools of Japanese encephalitis and 4 pools of Culex flavivirus were identified. In the case of Japanese encephalitis virus, 1 virus was detected from Culex pipiens pallens in the cow lairage in May, 1 virus from the Aedes vexans nipponii in the cow lairage in June, and 1 virus from Masonia uniformis in the cow by-product processing room. In the case of Culex flavivirus, 1 virus was detected from Masonia uniformis in the pig lairage in June, 1 virus from Culex pipiens pallens in the cow lairage in June, 1 virus from Culex pipiens pallens in the pig lairage in September, and 1 virus from Culex inatomii in the cow lairage in September (Fig. 1).

Figure 1. Amplification plot of Japanese encephalitis and Culex flavivirus. (a) Japanese encephalitis from Culex pipiens pallens caught in cow lairage in May. (b) Culex flavivirus from Culex pipiens pallens caught in pig lairage in June. (c) Japanese encephalitis from Mansonia uniformis caught in cow by-product processing room in June. (d) Japanese encephalitis from Aedes vexans nipponii caught in cow lairage in June. (e) Culex flavivirus from Culex pipiens pallens caught in cow lairage in June. (f) Culex flavivirus from Culex pipiens pallens caught in pig lairage in September. (g) Culex flavivirus from Culex innatomi caught in cow by-product processing room in September.

The minimal infection rate (MIR) of Japanese encephalitis virus was 3.390 in Culex pipiens pallens, 71.429 in the Masonia uniformis, and 3.135 in Aedes vexans nipponii (Table 5).

Table 5 . Comparison of the minimum infection rate (MIR) of Japanese encephalitis by species.

Species	No. of mosquito	No. of pools	Positive pool	MIR*
Anopheles sinensis	110	10
Anopheles koreicus	13	6
Culex pipiens pallens	295	21	1	3.390
Culex inatomii	19	5
Mansonia uniformis	14	3	1	71.429
Aedes albopictus	1	1
Aedes vexans nipponii	319	21	1	3.135
Armigeres subalbatus	49	6
Total	820	72

*Minimum Infection Rate (MIR)=(number of positive samples/total number of mosquitoes tested)×1,000..

This study investigated the distribution of mosquito species in the slaughterhouse in Daejeon and examined the presence of 7 zoonotic diseases. As a result of classifying 820 mosquitoes collected from March to November 2021 by species, the dominant species was Aedes vexans nipponii (38.9%), followed by the Culex pipiens pallens (35.93%). Comparing this with the results of the survey in the vicinity of Daejeon, in the case of Cheongju, it appeared as Culex pipiens pallens (62%) and Aedes vexans nipponii (18.8%), and in Sejong Culex pipiens pallens (36.3%) and Aedes vexans nipponii (30%), indicating that dominant specie of mosquitoes in the vicinity of Daejeon was Culex pipiens pallens (Park et al, 2018; Rhee et al, 2018). The reason for the difference between the results of this study and the distribution of mosquitoes in the vicinity of Daejeon is thought to be because the slaughterhouse is a place where livestock gather from all over the country, and mosquitoes that live in other areas are transferred together during livestock transportation.

According to the Daejeon Vector Mosquito Monitoring Project, the number of mosquitoes collected began to increase from June 2021, and the largest number of mosquitoes caught was from late July to early August. However, in this study, most mosquitoes were collected in the order of June, September, and July. In June, there was little precipitation and the temperature rose faster than usual due to the late rainy season, which increased the density of mosquitoes. However, in July and August, the number of mosquitoes appears to have decreased due to the loss of mosquito habitat and limited activity time of adults due to heavy precipitation (Park et al, 2018). Generally, in urban areas artificial habitats such as puddles, plastic bottles, and tires that provide habitats and wintering grounds for larvae have a great influence on mosquito ecology, so they are relatively less affected by rainfall. However, it is believed that slaughterhouses are heavily influenced by the environment because they are located in rural or suburban areas (Gleiser and Zalazar, 2010).

Japanese encephalitis infection is not expected to increase explosively because there are preventive vaccines for children and adults, and vaccination is performed according to the basic vaccination schedule for children. However, Japanese encephalitis advisories were issued in May from 1999 to 2004, in April from 2005 to 2019, and in March from 2020. This indicates that the time of emergence of Culex pipiens pallens is gradually accelerating (Korean Centers for disease control and prevention, 2021). Japanese encephalitis alerts have been issued between July and August since 1999, except for the one issued in September 2011. However, considering that the virus was detected in mosquitoes collected in May and June from the results of this study, there is a possibility that this can be gradually accelerated. The Japanese encephalitis vector was mainly Culex pipiens pallens and was isolated from more than 30 mosquito species (Pearce et al, 2018). Until now, the Japanese encephalitis virus has never been detected in Mansonia uniformis and Aedes vexans nipponii in Korea. However, judging from the results of this study, it is necessary to pay attention to mosquito species other than Culex pipien pallens.

Dengue fever, chikungunia fever, and Zika virus infection have no cases of native infection in Korea, but the situation is highly likely to change as mosquito vectors live and Culex flavivirus has been detected. So continuous monitoring is necessary because global warming is progressing quite rapidly, increasing number of overseas travelers, new urban development and population density are favorable conditions for the spread of mosquito-borne infectious diseases.

Since mosquitoes have a higher animal preference and livestock are included as hosts of various mosquito-borne infectious diseases, mosquito research on the slaughterhouse should be continuously conducted. In addition, investigations in the slaughterhouse are thought to be good for monitoring diseases because mosquitoes gather not only in one region, but throughout the country. As a result, it can be used as basic data for predicting infectious diseases and can be used to establish measures for mosquito control and prevention of infectious diseases.

This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through Animal Disease Management Technology Advancement Support Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (Project No. 122013-2).

No potential conflict of interest relevant to this article was reported.