Korean Journal of
Veterinary Service

Foot-and-mouth disease (FMD) is an acute infectious disease affecting cloven-hoofed animals such as pigs, cattle, and sheep. It is caused by the foot-and-mouth disease virus (FMDV), a member of the Picornaviridae family and the Aphthovirus genus. The disease is characterized by high fever, blisters on the tongue and inside the mouth, and lameness. FMDV comprises seven serotypes (A, O, C, SAT1, SAT2, SAT3, and Asia1), containing numerous subtypes (Knowles and Samuel, 2003). Due to the genetic variability of FMDVs, cross-protection between serotypes is impossible, necessitating the development of region-specific vaccines. When an outbreak occurs, rapid emergency vaccination is crucial; otherwise, the virus spreads swiftly, causing economic harm (Golde et al., 2005). Therefore, developing antiviral substances that are effective against all serotypes and implementing countermeasures using these substances are crucial for preventing FMD outbreaks. Furthermore, the current FMD vaccine is unable to produce protective antibodies against FMDV until 4∼7 days post-vaccination, and immunity against FMD takes at least 7 days to develop (Golde et al., 2005).

FMDV has an 8.5 kb single-strand RNA genome and consists of structural proteins (VP1, VP2, VP3, and VP4) and non-structural proteins (L^pro, 2A, 2B, 2C, 3A, 3B_1-3, 3C^pro, and 3D^pol) (Gao et al., 2016). Among these, 3D^pol, an RNA-dependent RNA polymerase (RdRp), plays a critical role in viral replication and is a primary target for developing antiviral drugs and inhibitors (Ryan et al., 1989; Durk et al., 2010). Antiviral agents are expected to have an immediate effect and are independent of viral antigenicity, thus minimizing the spread of infection and damage to the livestock industry. T-1105, a pyrazinecarboxamide compound, is a chemically stable defluorinated analog of T-705 (favipiravir). Unlike T-705, T-1105 exhibits enhanced structural stability and selectivity, making it a promising antiviral agent. Both compounds function as RdRp inhibitors, impeding viral RNA replication in RNA viruses such as Influenza A, Zika virus, and FMDV (Furuta et al., 2009; Huchting et al., 2018). T-1105 has demonstrated antiviral efficacy in vitro and in vivo, reducing viral replication and shedding in FMDV-infected animals (Furuta et al., 2009; Sakamoto et al., 2011; Nishi et al., 2022). The potential for immediate efficacy and independence from viral antigenicity highlights T-1105 as a valuable tool for managing FMD outbreaks. This study evaluates the antiviral efficacy of T-1105 against nine FMDV strains, including four Korean isolates, to further understand its potential in controlling FMDV infections.

Cells and viruses

Swine kidney cells (IBRS-2) were cultured using Dulbecco’s Modified Eagle’s Medium (Gibco, Eggenstein, Germany) with 10% fetal bovine serum (Gibco) and antibiotics (Gibco, 100 µg/mL penicillin and 100 µg/mL streptomycin). The viruses used in this study were obtained from the Pirbright Institute, a WOAH-designated reference laboratory, and included the following strains: O1/Manisa/Turkey/69 (Middle East-South Asia, MESA/PanAsia), A22/Iraq 24/64, A/Malaysia/97, Asia1/Shamir/89, and Asia/MOG/05. Additionally, the Korean isolates O/SKR/2000 (MESA/PanAsia), A/Pocheon/SKR/2010, O/Andong/SKR/2010 (South-East Asia, SEA/Mya-98), and O/SKR/2002 (MESA/PanAsia) were used.

Measurement of sensitivity index (SI)

We measured the 50% cytotoxic concentration (CC₅₀), which is defined as the concentration required to reduce cell viability by 50% compared to the control value, and the 50% inhibitory concentration (IC₅₀), which is defined as the concentration required to reduce virus-induced cytopathogenicity by 50% compared to the control value. The control antiviral agent of ribavirin (Sigma-Aldrich R9644, Darmstadt, Germany) and T-1105 (Toyama Chemical Co., Ltd., Japan) compounds were treated at different concentrations. For measuring CC₅₀, IBRS-2 cells were treated with the compound without FMDV for 72 hours at 37℃. For measuring IC₅₀, IBRS-2 cells were treated 100 TCID₅₀ of FMDV for one hour and then removed supernatant and treated with the compound for 72 hours at 37℃. The level of viability of the infected cells was determined by an MTS assay using CellTiter 96 AQueous One Solution Proliferation Assay (Promega, USA). The selectivity index (SI) was calculated based on the optical density results of CC₅₀ and IC₅₀ to determine the optimal concentration of the compound.

qRT-PCR

After infecting IBRS-2 with 100 TCID₅₀ of FMDV, the supernatant was removed and the cells were treated with the compound for 72 hours. Viral RNA was then extracted from the supernatant using a commercial RNeasy Mini Kits (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. To quantitatively assess the highly conserved region within the FMDV RNA polymerase (3D) gene, a quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) was performed using primers and probe set described by Callahan et al. (2002) (Table 1). The assay was carried out using an AccuPower Dual-HotStart^TM RT-qPCR PreMix (Bioneer, Daejeon, Republic of Korea), following the manufacturer’s instructions. The results were used to evaluate the effect of antiviral agents on FMDV RNA replication. Three separate experiments were repeated for each sample.

Table 1 . Sequences of primers and probe used for qRT-PCR.

Primer and probe	Primer and probe sequence (5’-3’)
Forward primer	ACTGGGTTTTACAAACCTGTGA
Reverse primer	GCGAGTCCTGCCACGGA
Probe (Taqman)	FAM-TCCTTTGCACGCCGTGGGAC-TAMRA

Statistical analysis

To evaluate the antiviral effects of T-1105 and Ribavirin against various FMDV strains, statistical significance was assessed using appropriate statistical tests. The normality of the data was first evaluated using the Shapiro-Wilk test. For data sets that met the assumption of normality, a paired t-test was conducted. In cases where the assumption of normality was violated, the Wilcoxon signed-rank test was applied. Given that Ribavirin data often did not follow a normal distribution, the Wilcoxon signed-rank test was predominantly used to compare the antiviral effects of T-1105 and Ribavirin across different FMDV strains. Statistical significance was defined as a P-value of less than 0.05. All statistical analyses were performed using Python’s scipy library.

Evaluation of the efficacy of compound T-1105

To confirm the efficacy of T-1105, we established the CC₅₀ and IC₅₀ concentrations for T-1105 using IBRS-2 and calculated the SI values based on these concentrations (Table 2). The results for CC₅₀ indicated that ribavirin, used as a control, exhibited 50% cytotoxicity at a concentration of 1822.5±245.37 µM, whereas T-1105 exhibited 50% cytotoxicity at 8971±106.77 µM. In terms of toxicity and safety, the T-1105 compound was approximately 4.9 times safer than ribavirin. The IC₅₀ results showed that ribavirin had a 50% inhibitory effect on the virus at concentrations ranging from 21.08 to 61.51 µM, depending on the virus isolate. Depending on the strain, the T-1105 compound demonstrated a 50% inhibitory effect at concentrations ranging from 416.15 to 1355 µM. However, the two Korean isolates, O/Andong/SKR/2010 and O/SKR/2002, exhibited no inhibitory response to T-1105. The SI value of T-1105 was highest in the A22/Iraq 24/64 strain at 21.56 (P< 0.00001). Other strains with high SI values included A/Malaysia/97 (P=0.012), O/SKR/2000 (P<0.00001), and A/Pocheon/SKR/2010 (P<0.00001). In contrast, SI values for O1/Manisa/Turkey/69 (P<0.00001), Asia1/Shamir/89 (P=0.00079), and Asia/MOG/05 (P<0.00001) were moderate. Overall, T-1105 inhibited viral growth in seven strains, excluding the two Korean isolates, O/Andong/SKR/2010 and O/SKR/2002.

Table 2 . Evaluation of sensitivity index (SI) value against different subtypes of FMDV.

Subtype of FMDV	Agent	CC50 (uM)a	IC50 (uM)b	SI (CC50/IC50)	Statistical significancec
O1/Manisa/Turkey/69	Ribavirin	1822.5±245.37	21.08±0.34	86.46	P<0.00001
	T-1105	8971±106.77	1042±454.25	8.61
A22/Iraq 24/64	Ribavirin	1822.5±245.37	24.54±3.48	74.27	P<0.00001
	T-1105	8971±106.77	416.15±26.44	21.56
A/Malaysia/97	Ribavirin	1822.5±245.37	34.53±28.84	52.78	P=0.012
	T-1105	8971±106.77	502.87±26.21	17.84
Asia1/Shamir/89	Ribavirin	1822.5±245.37	42.14±0.8	43.25	P=0.00079
	T-1105	8971±106.77	1355±36.77	6.62
Asia1/MOG/05	Ribavirin	1822.5±245.37	61.51±19.35	29.62	P<0.00001
	T-1105	8971±106.77	660.95±89.02	13.57
O/SKR/2000	Ribavirin	1822.5±245.37	34.62±6.21	52.64	P<0.00001
	T-1105	8971±106.77	549.3±192.18	16.33
A/Pocheon/SKR/2010	Ribavirin	1822.5±245.37	39.81±16.18	45.78	P<0.00001
	T-1105	8971±106.77	556.48±190.24	16.12
O/Andong/SKR/2010	Ribavirin	1822.5±245.37	50.46±14.99	36.12	P<0.001
	T-1105	NAE	NAE
O/SKR/2002	Ribavirin	1822.5±245.37	34.34±2.71	53.07	P<0.0001
	T-1105	NAE	NAE

^aThe 50% cytotoxic concentration was defined as the compound’s concentration required for the reduction of cell viability by 50%..

^bThe half maximal inhibitory concentration was defined as the compound’s concentration required for the reduction of virus-induced cytopathogenicity by 50%. Data shown are the mean±standard deviations of three independent experiments (Student’s t test). NAE, Antiviral effect has not been confirmed..

^cStatistical significance was assessed using the Wilcoxon signed-rank test for each FMDV strain. P<0.05 was considered statistically significant..

Antiviral effect of compound T-1105

Since T-1105 is a viral polymerase inhibitor, it is believed to inhibit viral replication. Using qRT-PCR, the viral RNA copy number was quantified for each strain based on ribavirin and T-1105 concentrations (Fig. 1). Ribavirin effectively reduced the viral RNA copy number across all FMDV subtypes at concentrations exceeding 45 µM. In contrast, T-1105 significantly decreased the viral RNA copy number at concentrations above 720 µM in three strains: A22/Iraq 24/64 (P<0.00001), A/Malaysia/97 (P=0.012), and A/Pocheon/SKR/2010 (P<0.00001) (Fig. 1B, 1C, 1G). For other strains such as O1/Manisa/Turkey/69 (P<0.00001), Asia1/Shamir/89 (P=0.00079), Asia1/MOG/05 (P<0.00001), significantly higher concentrations above 1440 µM were required to achieve a similar antiviral effect (Fig. 1A, 1D∼F). The Korean isolates O/Andong/SKR/2010 (P<0.001) and O/SKR/2002 (P<0.0001) showed limited response, with no confirmed antiviral effect at the tested concentrations (Fig. 1H, 1I). RT-PCR results indicate that T-1105 is highly effective against serotype A viruses. However, for serotypes O and Asia, higher concentrations are necessary, or the compound shows no efficacy.

Figure 1. IBRS-2 cells were inoculated with 100 TCID₅₀ of each FMDV strain for 1 hour, followed by treatment with T-1105 or Ribavirin at varying concentrations. After 72 hours of incubation, RNA was extracted from the supernatants and quantified using quantitative real-time RT-PCR. Box plots illustrate the distribution of viral RNA copy numbers for T-1105 and Ribavirin. Error bars represent standard deviations (SD). Statistically significant reductions in viral RNA copy numbers were observed for T-1105 across all concentrations compared to Ribavirin for all strains, with P<0.05 for all comparisons. (A∼I) Panels represent results for individual FMDV strains: O1/Manisa/Turkey/69 (A), A22/Iraq 24/64 (B), A/Malaysia/97 (C), Asia1/Shamir/89 (D), Asia1/MOG/05 (E), O/SKR/2000 (F), A/Pocheon/SKR/2010 (G), O/Andong/SKR/2010 (H), and O/SKR/2002 (I).

In this study, we evaluated the antiviral efficacy of T-1105 against nine different strains of FMDV, including strains from the Republic of Korea. Our findings revealed variability in the efficacy of T-1105 across different serotypes and subtypes, particularly when compared to the widely-used antiviral agent ribavirin, which served as a reference material in this study. The precise mechanism by which T-705 and T-1105 inhibit viral polymerase remains unclear, necessitating further research to elucidate their physiological functions. Among the six antiviral drugs evaluated for their efficacy against FMDV (Nevirapine, Efavirenz, Delavirdine, T-705, T-1105, and T-1106), T-1105 demonstrated the most significant effect. Notably, significant antiviral efficacy was observed for three serotypes: A22/Iraq, C/Philippine, and Asia1/Shami (Sakamoto et al., 2011). The administration of fast-acting antiviral agents like T-1105 can prevent infection and meaningfully suppress viral proliferation in the early stages. Previous studies have shown that T-1105 inhibits the early stages of FMDV infection (Nishi et al., 2022). Additionally, when the T-1105 was administered to pigs infected with FMD, clinical symptoms were suppressed, and virus shedding was reduced, as confirmed through serum analysis (Nishi et al., 2022). Ribavirin, known for its broad-spectrum antiviral effects, inhibits RNA-capping activity or viral polymerase and increases mutation frequency (Gu et al., 2006; Kim et al., 2012). In this study, we evaluated the antiviral efficacy of ribavirin and T-1105 against nine FMDV strains, including Korean isolates. Our results confirmed that T-1105 exhibited approximately 4.9 times less cytotoxicity compared to ribavirin. The SI values obtained through CC₅₀ and IC₅₀ showed that the antiviral efficacy of T-1105 was 3 to 7 times lower than that of ribavirin. However, the antiviral effect of T-1105 at a concentration of 720 µM or higher was confirmed in selected strains.

As shown in our results, the antiviral effects were evaluated as superior against serotypes A and Asia; however, differences were observed among subtypes in the case of serotype O. Specifically, the SI values indicated higher efficacy of T-1105 against serotype A (such as A22/Iraq 24/64, A/Pocheon/SKR/2010 and A/Malaysia/97), Asia (such as Asia1/Shamir/89 and Asia1/MOG/05), and O (such as O1/Manisa/Turkey/69 and O/SKR/2000) strains, while serotype O isolates (O/Andong/SKR/2010 and O/SKR/2002) showed resistance. This variability contrasts with previous studies reporting T-1105’s broad efficacy across all FMDV serotypes (Furuta et al., 2009; Nishi et al., 2022).

The differential antiviral response observed between the O/SKR/2000 and O/SKR/2002 strains, both classified under the MESA topotype and Pan Asia strain, underscores the impact of genetic evolution on antiviral efficacy. Notably, the O/SKR/2002 strain exhibited unique amino acid substitutions in the VP1 protein at positions 144 and 152 (Oem et al., 2005), which may have influenced its susceptibility to the antiviral compound T-1105. These specific mutations could potentially alter the interaction between the virus and the drug, thereby affecting the inhibition of viral replication. Additionally, variations in the RdRp gene between the two strains might contribute to the observed differences in response to T-1105. Mutations within the RdRp gene can modify the binding affinity or activity of RdRp inhibitors like T-1105 (George et al., 2001). Although this study did not include a detailed examination of the RdRp sequence, future analyses could reveal critical differences that account for the reduced efficacy of T-1105 against the O/SKR/2002 strain. Despite both strains belonging to the same serotype and topotype, even minor genetic variations can significantly influence viral replication mechanisms and antiviral resistance. The evolutionary trajectory of the O/SKR/2002 strain from O/SKR/2000 may have introduced changes that affect its susceptibility to T-1105, highlighting the importance of ongoing surveillance of genetic mutations in circulating FMDV strains.

In conclusion, our findings emphasize the necessity for further research into the molecular basis for these observed differences in T-1105 efficacy. Comparative analyses of the RdRp gene and other viral proteins between strains are essential to elucidate the role of genetic mutations in antiviral resistance. A deeper understanding of these mechanisms at the molecular level will be crucial for developing more effective antiviral strategies to control FMDV outbreaks. This study evaluated the antiviral efficacy of the T-1105 compound against FMDV subtypes using in vitro cell culture models. Based on these results, further animal testing and strategic research are warranted to confirm the efficacy of T-1105 against various FMDV isolates and to ensure its potential as a viable antiviral agent against FMDV.

We thank Japanese scientist Kenichi Sakamoto (Center for Animal Disease Control, University of Miyazaki, 1-1, Gakuenkibanadai-nishi, Miyazaki, 889-2192, Japan) for kindly providing T-1105.

This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through High-Risk Animal Infectious Disease Control Technology Development Project, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (RS-2024-00399808) and by the Basic Science Research Program through Korea Basic Science Institute (National research Facilities and Equipment Center) grant funded by the Ministry of Education (grant number: 2021R1A6C101C369).

No potential conflict of interest relevant to this article was reported.