Top
Search 닫기

Short Communication

Split Viewer

Korean J. Vet. Serv. 2024; 47(1): 41-48

Published online March 30, 2024

https://doi.org/10.7853/kjvs.2024.47.1.41

© The Korean Socitety of Veterinary Service

Molecular screening of Feline bocaviruses (FBoVs) from captured wild felids in Korea

Yong-Gu Yeo 1†, Jong-Min Kim 1†, Hye-Ryung Kim 1,2, Jonghyun Park 1,2, Jung-Hoon Kwon 1, Oh-Deog Kwon 1*, Choi-Kyu Park 1*

1College of Veterinary Medicine & Institute for Veterinary Biomedical Science, Kyungpook National University, Daegu 41566, Korea
2DIVA Bio Incorporation, Daegu 41519, Korea

Correspondence to : Oh-Deog Kwon
E-mail: odkwon@knu.ac.kr
https://orcid.org/0000-0002-2538-5803

Choi-Kyu Park
E-mail: parkck@knu.ac.kr
https://orcid.org/0000-0002-0784-9061

These first two authors contributed equally to this work.

Received: March 4, 2024; Revised: March 11, 2024; Accepted: March 12, 2024

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Feline bocavirus (FBoV) is considered an emerging pathogen recently identified in domestic cats worldwide. To date, three species of FBoVs (FBoV-1, FBoV-2, and FBoV-3) have been reported, but there are no reports identifying FBoVs in Korea. In this study, we detected novel FBoVs for the first time in Korea in captive wild felids (four European lynx and a lion) kept at Seoul Zoo. In FBoV-positive fecal samples, not only singular infections but also dual or triple infections with three different species of FBoVs were confirmed, suggesting that three species of FBoVs are already introduced and co-circulated in susceptible host animals in Korea. These results will help expand our understanding of the geographical distribution and host susceptibility of novel FBoVs. Further studies are necessary to determine the infection status of FBoVs in domestic cats and the genetic characteristics of the viruses circulating in Korea.

Keywords Feline bocavirus, Molecular screening, European lynx, Lion, Korea

Parvoviruses in the family Parvoviridae are currently classified into three subfamilies, Densovirinae, Parvovirinae, and Hamaparvovirinae, members of which infect non-vertebrate, vertebrate, and both non-vertebrate and vertebrate hosts, respectively. The subfamily Parvovirinae is divided into eleven genera based on the recently revised taxonomy: Amdoparvovirus, Artiparvovirus, Aveparvovirus, Bocaparvovirus, Copiparvovirus, Dependoparvovirus, Erythroparvovirus, Loriparvovirus, Protoparvovirus, Sandeparvovirus, and Tetraparvovirus (Cotmore et al, 2019; Pénzes et al, 2020). Bocavirus (BoV), belonging to the genus Bocaparvovirus within the subfamily Parvovirinae, is considered an emerging pathogen and has been detected in a wide range of hosts, including humans, cats, cows, pigs, gorillas, chimpanzees, California sea lion, rabbits, Himalayan marmots, camels, wild boars, bats, minks, house shrews, Amur leopard cat, Eastern roe deer, and rodents (Aryal and Liu, 2021; Liu et al, 2022; Sun et al, 2023). Currently, members of BoV are classified into thirty-one species based on the ICTV classification criteria: Bocaparvovirus carnivoran1 to 7, Bocaparvovirus chiropteran1 to 5, Bocaparvovirus incertum1, Bocaparvovirus largomorph1, Bocaparvovirus pinniped1 and 2, Bocaparvovirus primate1 to 3, Bocaparvovirus rodent1 to 3, and Bocaparvovirus ungulate1 to 9. Among these, Bocaparvovirus carnivoran3, 4, and 5, also known as feline bocavirus 1 (FBoV-1), FBoV-2, and FBoV-3, have been founded in domestic cats with variable clinical signs (Capozza et al, 2021; ICTV, 2024).

FBoV was first identified from stray cats in Hong Kong in 2012 (Lau et al, 2012), and then designated as a species named Bocaparvovirus carnivoran3, according to the new strict classification criteria of ICTV (Cotmore et al, 2019; Pénzes et al, 2020). FBoV-2 was subsequently discovered in the feces of a single healthy cat from Portugal (Ng et al, 2014). The detected FBoV-2 POR1 strain was genetically distinct from FBoV-1 strains previously identified in Hong Kong and now classified as a different species, Bocaparvovirus carnivoran4. FBoV-3 was detected in fecal samples collected from sheltered cats in the United States in 2014 and was classified as the third FBoV (species Bocaparvovirus carnivoran5) because it showed low amino acid homology to previously identified FBoV-1 and FBoV-2 (Zhang et al, 2014). Since then, these three species of FBoVs have been identified in cats with and without clinical signs in several countries, including Europe, China, Japan, Thailand, Canada, and Australia, suggesting that genetically and biologically different FBoVs are spreading in cat populations around the world (Ng et al, 2014; Takano et al, 2016; Liu et al, 2018; Yi et al, 2018; Piewbang et al, 2019; Li et al, 2020; Van Brussel et al, 2022).

To date, BoV infections have been reported in humans (Chung et al, 2006), pigs (Choi et al, 2014; Yoo et al, 2015), and dogs (Choi et al, 2015; Koh et al, 2020) in Korea, but have not been reported in domestic cats and wild felids. In this study, molecular screening was carried out with fecal samples collected from five species of captured wild felids to identify novel FBoVs in Korea. These results will help expand our knowledge of epidemiology and virology of FBoVs in Korea.

Clinical samples

A total of 35 fecal samples were collected from five different species of wild felids, including four Eurasian lynxes (Lynx lynx), twelve leopard cats (Prionailurus bengalensis), eleven Siberian tigers (Panthera tigris), three leopards (Panthera pardus), and five lions (Panthera reo) in the Seoul Zoo in 2024. All animals were clinically healthy without any clinical signs suspected with enteric diseases at the time of sample collection. The collected samples were stored at −80℃ until processing. The samples to be used in this study were collected by veterinarians at the Seoul Zoo without any animal contact, ethical approval from our institute regarding the animals was not required.

Nucleic acid extraction

Each collected fecal sample was immersed in 1 mL of phosphate-buffered saline (0.15 M, pH 7.2) and then centrifuged at 3000 × g for 10 min. Then, supernatants were aliquoted and stored at −80℃ for further analysis. Total nucleic acids were extracted from the 200 uL of collected swab samples using a TANBead Nucleic Acid Extraction Kit with a fully automated magnetic bead operating platform (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan), according to the manufacturer’s directions. The extracted nucleic acids were allocated and stored at −80℃ until further use.

Molecular screening of feline bocaparvoviruses

Molecular screening for three species of FBoVs (FBoV-1, FBoV-2, and FBoV-3) was carried out with SYBR Green-based real-time quantitative polymerase chain reaction (qPCR) assays using each virus-specific primer and a commercial qPCR kit [RealHelixTM qPCR kit (Green), NanoHelix, Daejeon, Republic of Korea] according to the manufacturer’s instructions. Previously described primers for FBoV-1 (Lau et al, 2012), FBoV-2 (Ng et al, 2014), and FBoV-3 (Zhang et al, 2014) were used in the qPCR assays (Table 1). The qPCR program was identical to the following conditions: initial denaturation at 95℃ for 15 min, followed by 40 cycles at 95℃ for 15 s, and 60℃ for 60 s for amplification. Fluorescence signals generated by SYBR Green dye for tested samples were measured at the end of each annealing step and the cycle threshold (Ct) values for each sample were calculated by determining the point at which the fluorescence exceeded the threshold limit. To interpret the qPCR results, samples with a Ct value of less than 37 were considered positive, whereas those with Ct values of higher than 37 were considered negative.

Table 1 . Primers used in real-time PCR assay for screening of feline bocaparvoviruses (FBoV) in this study

PathogenPrimerSequence (5’–3’)Amplicon size (bp)Reference
FBoV-1FBoV1F
FBoV1R
TCTACAAGTGGGACATTGGA
GAGCTTGATTGCATTCACGA
133Lau et al (2012)
FBoV-2FBoV2AF
FBoV2AR
TCGTTCGTCTTGGAACATAGC
CAGAGCGTGGATCTGTCTGA
331Ng et al (2014)
FBoV-3FBD1L2
FBD1R2
CAAAGGATCGGGAGCGGGCG
TGCCCATGGTGTTGTGATTCCTATCCA
388Zhang et al (2014)

In this study, we conducted molecular screening of feline infectious viral pathogens as part of disease monitoring on wild felids raised in the Seoul Zoo. Through this, we were fortunate to confirm that European lynx and lion in the zoo were exposed to novel FBoVs. All three species of FBoV DNAs were detected from five fecal samples collected from four European lynxes and a lion (Table 2). FBoV-1 DNAs were detected from all four fecal samples of European lynxes, FBoV-2 DNAs were detected from two fecal samples of a European lynx and a lion, and FBoV-3 DNAs were detected from three fecal samples from two European lynx and a lion, respectively (Table 2, Fig. 1). Furthermore, co-infection of FBoV-1, FBoV-2, and/or FBoV-3 also was identified in the FBoV-positive samples in this study (Table 3). These results showed that three species of FBoVs have already been introduced in Korea and are infected in some captive wild felids such as European lynx and lion as determined in this study.

Table 2 . Molecular detection of feline bocaparvoviruses (FBoV) in fecal samples of captive wild felids

SpeciesCommon nameNo. of samplesDetection of FBoV (No. of positive)
FBoV-1FBoV-2FBoV-3
Lynx lynxEurasian lynx4412
Prionailurus bengalensisLeopard cat12000
Panthera tigrisSiberian tiger11000
Panthera pardusLeopard3000
Panthera reoLion5011
Total35423


Table 3 . Details of diagnostic results for feline bocaparvovirus (FBoV)-positive samples

SpeciesSample IDResults of real-time PCR assay (Ct value)
FBoV-1FBoV-2FBoV-3
Lynx lynx (European lynx)LL127.81-33.33
LL234.00--
LL328.2334.6234.93
LL436.06--
Panthera reo (Lion)PR4-33.3633.46

-, negative results (>37 of Ct value)



Fig. 1.Amplification curve of real-time PCR assay for feline bocaparvoviruses from wild felids. The positive signals of real-time PCR assay for feline bocaparvovirus 1 (FBoV-1) (A), FBoV-2 (B), and FBoV-3 (C) were generated with five fecal samples obtained from four European lynxes (Lynx lynx) and a lion (Panthera reo). Detailed information of positive samples is provided in Table 3.

As an apex predator, the Eurasian lynx (Lynx lynx) and lion (Panthera reo) play important and unique roles in the natural functioning of ecosystems. These two species have been listed as “Least Concern” or “Critically Endangered” species on the International Union for the Conservation of Nature (IUCN) Red List, respectively (Ripple et al, 2014). Despite the efforts for species conservation, the life of the endangered feline species is threatened by some feline infectious pathogens worldwide. Previous studies showed that wild lynxes and lions are susceptible to several feline viral pathogens such as feline parvovirus, feline herpesvirus, feline calicivirus, feline leukemia virus, feline immunodeficiency virus, and canine distemper virus (Schmidt-Posthaus et al, 2002; Ramsauer et al, 2007; Meli et al, 2009; Roelke et al, 2009; Wasieri et al, 2009; Lane et al, 2016; Weckworth et al, 2020; Nájera et al, 2021; Ryser-Degiorgis et al, 2021). However, there have been few studies on the infectious viral disease in captive European lynx and lions in Korea. The finding in this study that FBoV DNAs were identified in fecal samples of European lynx and lion helps to expand our knowledge about the host range of the novel FBoVs and its epidemiology in wild felids.

The origin and transmission route of FBoVs detected in the lynxes and lion are unknown in this study. However, considering that interspecies transmission of feline pathogens between domestic cats and captive wild felids has been frequently reported in several countries, including Korea (Meli et al, 2009; Weckworth et al, 2020; Sacristán et al, 2021; Yeo et al, 2023), the FBoVs detected in wild felids in this study is presumed to have been transmitted from infected domestic cats. In this regard, it is worth noting a previous report that Siberian tigers at this zoo were infected with FPV due to cross-species transmission between tigers and stray cats roaming the zoo (Yeo et al, 2023). However, there are no studies on FBoV infections in the Korean domestic cat population yet. Therefore, further studies are urgently needed to investigate the infection status of FBoVs in Korean domestic cats.

Despite the wide distribution of the three species of FBoVs, co-infection cases of FBoV-1, FBoV-2, and/or FBoV-3 have been rarely reported in domestic cats (Ng et al, 2014; Takano et al, 2016; Liu et al, 2018; Piewbang et al, 2019; Li et al, 2020; Van Brussel et al, 2022). In a recent study carried out in China, co-infection cases of FBoV-1 and FBoV-2 were reported in domestic cats, although the co-infection rate of FBoV-1 and FBoV-2 was much lower than that of singular infection of FBoV-1 or FBoV-2 (Yi et al, 2018). Therefore, the co-infection status of three FBoVs was investigated by using each species-specific monoplex qPCR assays in this study. Of the five FBoV-positive samples, two were singularly infected with FBoV-1 (sample ID LL2 and LL4), but two were dually infected with FBoV-1 and FBoV-3 (sample ID LL1) or FBoV-2 and FBoV-3 (sample ID PR4). Surprisingly, one fecal sample collected from a Eurasian lynx (sample ID LL3) was triply infected with all three species of FBoVs (Table 3, Fig. 1). These results suggested that co-infections of two of three different species of FBoVs frequently occur in susceptible host populations. In this regard, more advanced multiplex qPCR assays are required for simultaneous and differential detection of three species of FBoVs from clinical samples in a single reaction.

There are some limitations in this study. First, viral sequence analysis is important to characterize the Korean FBoVs detected in this study. However, our efforts for genetic sequencing of the detected FBoVs failed in this study due to the low viral loads (high Ct values) in the FBoV-positive clinical samples as shown in Table 3 and Fig. 1. Therefore, further studies are needed to elucidate the genetic characteristics of Korean FBoVs and their relationship with other FBoV strains reported in foreign countries. Second, the molecular screening of FBoVs in this study confirmed that the viruses are infected in susceptible wild felids in a Korean zoo, suggesting that the viruses might be circulating in the Korean domestic cat population. However, surveillance of the viruses in Korean domestic cats was not included in the scope of this study. Therefore, further epidemiological studies are required to investigate the infection status of FBoVs in the Korean domestic cat population. Furthermore, considering that various viral and bacterial pathogens are commonly co-infected in the cat population in Korea (Koh et al, 2020; Kim et al, 2022; Baek et al, 2023a; Baek et al, 2023b), further epidemiological studies are necessary to determine the co-infection status of the novel FBoV and other feline pathogens in Korean cat population.

In conclusion, we confirmed that three species of FBoVs were infected in two species of wild felids (Lynx lynx and Panthera reo) in this study. To the best of our author’s knowledge, this is the first report on the detection of noble FBoVs from captive wild felids in Korea. These results will contribute to expanding our understanding of the geographical distribution and host susceptibility of the novel FBoVs. Further studies are necessary to investigate the infection status of FBoVs in domestic cats and the genetic characteristics of the viruses circulating in Korea.

This work was supported by the research grants from the Animal and Plant Quarantine Agency (Project No. Z-1543085-2022-23-03), Ministry of Agriculture, Food and Rural Affairs (MAFRA), Republic of Korea.

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study was conducted in 2024 and was beyond the purview of the Institutional Animal Care and Use Committee (IACUC) at Kyungpook National University (KNU), as the KNU IACUC only evaluates proposals using laboratory animals maintained in indoor facilities and not research involving outdoor animals. The fecal samples from captive wild animals were collected by veterinarians working at Seoul Zoo’s veterinary clinic without any restraint on the wild animals.

No potential conflict of interest relevant to this article was reported.

  1. Aryal M and Liu G. 2021. Porcine bocavirus: A 10-year history since its discovery. Virol Sin 36(6):1261-1272.
    Pubmed KoreaMed CrossRef
  2. Baek JS, Kim JM, Kim HR, Park JH, Shin YK, Kang HE, Kwon JH, Lee WJ, Jang M, Lee SK, Cho HS, Oh Y, Park CK. 2023a. Development and evaluation of a triplex real-time quantitative reverse transcription-polymerase chain reaction for rapid and differential detection of three feline respiratory viral pathogens. Korean J Vet Serv 46(4):269-281.
    CrossRef
  3. Baek JS, Kim JM, Kim HR, Shin YK, Kwon OK, Park CK. 2023b. Prevalence of feline calicivirus in Korean cats determined by an improved real-time RT-PCR assay. Korean J Vet Serv 46(2):123-135.
    CrossRef
  4. Capozza P, Martella V, Decaro N. 2021. Emerging parvoviruses in domestic cats. Viruses 2021 13(6):1077.
    Pubmed KoreaMed CrossRef
  5. Choi JW, Lee KH, Lee JI, Lee MH, Oem JK. 2015. Genetic characteristics of canine bocaviruses in Korean dogs. Vet Microbiol 179(3-4):177-183.
    Pubmed KoreaMed CrossRef
  6. Choi MG, Park SJ, Nguyen VG, Chung HC, Park BK. 2014. Molecular detection and genetic analysis of porcine bocavirus in Korean domestic swine herds. Arch Virol 159(6):1487-1492.
    Pubmed CrossRef
  7. Chung JY, Han TH, Kim SW. 2006. Bocavirus infection in hospitalized children, South Korea. Emerg Infect Dis 12(8):1254-1256.
    Pubmed KoreaMed CrossRef
  8. Cotmore SF, Agbandje-McKenna M, Canuti M, Chiorini JA, Eis-Hubinger AM, Hughes J, Mietzsch M, Modha S, Ogliastro M, Pénzes JJ, Pintel DJ, Qiu J, Soderlund-Venermo M, Tijssen P; Ictv Report Consortium. 2019. ICTV Virus Taxonomy Profile: Parvoviridae. J Gen Virol 100(3):367-368.
    Pubmed KoreaMed CrossRef
  9. ICTV, International Committee on Taxonomy of Viruses. [(accessed on 5 January 2024)]; Available online: https://talk.ictvonline.org/ictv-reports/ictv_online_report/ssdna-viruses/w/parvoviridae.
  10. Kim HR, Jeon GT, Kim JM, Baek JS, Shin YK, Kwon OK, Kang HE, Cho HS, Park CK. 2022. Prevalence of Bordetella bronchiseptica, Mycoplasma felis, and Chlamydia felis using a newly developed triplex real-time polymerase chain reaction assay in Korean cat population. Korean J Vet Serv 45(4):305-316.
    CrossRef
  11. Koh BRD, Kim HN, Kim HJ, Oh AR, Jung BR, Park JS, Lee JG, Kim YH. 2020. A survey of respiratory pathogens in dogs for adoption in Gwangju metropolitan city animal shelter, South Korea. Korean J Vet Serv 43(2):67-77.
  12. Lane EP, Brettschneider H, Caldwell P, Oosthuizen A, Dalton DL, du Plessis L, Kotze A. 2016. Feline panleukopaenia virus in captive non-domestic felids in South Africa. Onderstepoort J Vet Res 83(1):a1099.
    Pubmed KoreaMed CrossRef
  13. Lau SKP, Woo PCY, Yeung HC, Teng JLL, Wu Y, Bai R, Fan RYY, Yuen KY. 2012. Identification and characterization of bocaviruses in cats and dogs reveals a novel feline bocavirus and a novel genetic group of canine bocavirus. J Gen Virol 93(7):1573-1582.
    Pubmed CrossRef
  14. Li Y, Gordon E, Idle A, Altan E, Seguin MA, Estrada M, Delwart E. 2020. Virome of a feline outbreak of diarrhea and vomiting includes Bocaviruses and a novel Chapparvovirus. Viruses 12(5):506.
    Pubmed KoreaMed CrossRef
  15. Liu C, Liu F, Li Z, Liu D. 2018. First report of feline bocavirus associated with severe enteritis of cat in Northeast China, 2015. J Vet Med Sci 80(4):731-735.
    Pubmed KoreaMed CrossRef
  16. Liu Y, Sun L, Tu Z, Sun S, Sun Y, Yi L, He B. 2022. Virome profiling of an Amur leopard cat reveals multiple Anelloviruses and a Bocaparvovirus. Vet Sci 9(11):640.
    Pubmed KoreaMed CrossRef
  17. Meli ML, Cattori V, Martínez F, López G, Vargas A, Simón MA, Zorrilla I, Muñoz A, Palomares F, López-Bao JV, Pastor J, Tandon R, Willi B, Lutz H. 2009. Feline leukemia virus and other pathogens as important threats to the survival of the critically endangered Iberian lynx (Lynx pardinus). PLoS One 4(3):e4744.
    Pubmed KoreaMed CrossRef
  18. Nájera F, Grande-Gómez R, Peña J, Vázquez A, Palacios MJ, Rueda C, Corona-Bravo AI, Zorrilla I, Revuelta L, Jiménez J. 2021. Disease surveillance during the reintroduction of the Iberian lynx (Lynx pardinus) in Southwestern Spain. Animals 11:547.
    Pubmed KoreaMed CrossRef
  19. Ng TF, Mesquita JR, Nascimento MS, Kondov NO, Wong W, Reuter G, Knowles NJ, Vega E, Esona MD, Deng X, Delwart E. 2014. Feline fecal virome reveals novel and prevalent enteric viruses. Vet Microbiol 171(1-2):102-111.
    Pubmed KoreaMed CrossRef
  20. Pénzes JJ, Söderlund-Venermo M, Canuti M, Eis-Hübinger AM, Hughes J, Harrach B. 2020. Reorganizing the family Parvoviridae: a revised taxonomy independent of the canonical approach based on host association. Arch Virol 165(9):2133-2146.
    Pubmed CrossRef
  21. Piewbang C, Kasantikul T, Techangamsuwan S. 2019. Feline bocavirus-1 associated with outbreaks of hemorrhagic enteritis in household cats: potential first evidence of a pathological role, viral tropism and natural genetic recombination. Sci Rep 9(1):16367.
    Pubmed KoreaMed CrossRef
  22. Ramsauer S, Bay G, Meli M, Lutz H. 2007. Seroprevalence of selected infectious agents in a free-ranging, low-density lion population in the Central Kalahari Game Reserves in Botswana. Clin Vaccine Immunol 14(6):808-810.
    Pubmed KoreaMed CrossRef
  23. Ripple WJ, Estes JA, Beschta RL, Wilmers CC, Ritchie EG, Hebblewhite M, Berger J, Elmhagen B, Letnic M, Nelson MP, Schmitz OJ, Smith DW, Wirsing AJ. 2014. Status and ecological effects of the world's largest carnivores. Science 343(6167):1241484.
    Pubmed CrossRef
  24. Roelke ME, Brown MA, Troyer JL, Winterbach H, Winterbach C, Hemson G, Smith D, Johnson RC, Pecon-Slattery J, Roca AL, Alexander KA, Klein L, Martelli P, O'Brien SJ. 2009. Pathological manifestations of feline immunodeficiency virus (FIV) infection in wild African lions. Virology 390(1):1-12.
    Pubmed KoreaMed CrossRef
  25. Ryser-Degiorgis MP, Marti I, Pisano SRR, Pewsner M, Wehrle M, Breitenmoser-Würsten C, Origgi FC, Kübber-Heiss A, Knauer F, Posautz A, Eberspächer-Schweda M, Huder JB, Böni J, Kubacki J, Bachofen C, Riond B, Meli ML. 2021. Management of suspected cases of feline immunodeficiency virus infection in Eurasian lynx (Lynx lynx) during an international translocation program. Front Vet Sci 8:730874.
    Pubmed KoreaMed CrossRef
  26. Sacristán I, Acuña F, Aguilar E, García S, José López M, Cabello J, Hidalgo-Hermoso E, Sanderson J, Terio KA, Barrs V, Beatty J, Johnson WE, Millán J, Napolitano C. 2021. Cross-species transmission of retroviruses among domestic and wild felids in human-occupied landscapes in Chile. Evol Appl 14(4):1070-1082.
    Pubmed KoreaMed CrossRef
  27. Schmidt-Posthaus H, Breitenmoser-Würsten C, Posthaus H, Breitenmoser U. 2002. Causes of mortality in reintroduced Eurasian lynx in Switzerland. J Wildl Dis 38(1):84-92.
    Pubmed CrossRef
  28. Sun Y, Sun L, Sun S, Tu Z, Liu Y, Yi L, He B. 2023. Virome profiling of an Eastern roe deer reveals spillover of viruses from domestic animals to wildlife. Pathogens 12(2):156.
    Pubmed KoreaMed CrossRef
  29. Takano T, Takadate Y, Hohdatsu T. 2016. Genetic characterization of feline bocavirus detected in cats in Japan. Arch Virol 161(10):2825-1828.
    Pubmed KoreaMed CrossRef
  30. Van Brussel K, Wang X, Shi M, Carrai M, Feng S, Li J, Holmes EC, Barrs VR. 2022. The enteric virome of cats with feline panleukopenia differs in abundance and diversity from healthy cats. Transbound Emerg Dis 69(5):e2952-e2966.
    Pubmed KoreaMed CrossRef
  31. Wasieri J, Schmiedeknecht G, Förster C, Reinacher M. 2009. Parvovirus infection in a Eurasian lynx (Lynx lynx) and in a European wildcat (Felis silvestris silvestris). J Comp Pathol 140(2-3):203-207.
    Pubmed CrossRef
  32. Weckworth JK, Davis BW, Dubovi E, Fountain-Jones N, Packer C, Cleaveland S, Craft ME, Eblate E, Schwartz M, Roelke-Parker M. 2020. Cross-species transmission and evolutionary dynamics of canine distemper virus during a spillover in African lions of Serengeti National Park. Mol Ecol 29(22):4308-4321.
    Pubmed CrossRef
  33. Yeo YG, Kim HR, Park J, Kim JM, Shin YK, Lee KK, Kwon OK, Jeoung HY, Kang HE, Ku BK, Park SC, Park CK. 2023. Epidemiological and molecular approaches for a fatal feline panleukopenia virus infection of captive Siberian tigers (Panthera tigris altaica) in the Republic of Korea. Animals (Basel) 13(18):2991.
    Pubmed KoreaMed CrossRef
  34. Yi S, Niu J, Wang H, Dong G, Zhao Y, Dong H, Guo Y, Hu G. 2018. Detection and genetic characterization of feline bocavirus in Northeast China. Virol J 15(1):125.
    Pubmed KoreaMed CrossRef
  35. Yoo SJ, Sunwoo SY, Ko SS, Je SH, Lyoo YS. 2015. A novel porcine bocavirus harbors a variant NP gene. Springerplus. 4:370.
    Pubmed KoreaMed CrossRef
  36. Zhang W, Li L, Deng X, Kapusinszky B, Delwart E. 2014. Faecal virome of cats in an animal shelter. J Gen Virol 95(11):2553-2564.
    Pubmed KoreaMed CrossRef

Article

Short Communication

Korean J. Vet. Serv. 2024; 47(1): 41-48

Published online March 30, 2024 https://doi.org/10.7853/kjvs.2024.47.1.41

Copyright © The Korean Socitety of Veterinary Service.

Molecular screening of Feline bocaviruses (FBoVs) from captured wild felids in Korea

Yong-Gu Yeo 1†, Jong-Min Kim 1†, Hye-Ryung Kim 1,2, Jonghyun Park 1,2, Jung-Hoon Kwon 1, Oh-Deog Kwon 1*, Choi-Kyu Park 1*

1College of Veterinary Medicine & Institute for Veterinary Biomedical Science, Kyungpook National University, Daegu 41566, Korea
2DIVA Bio Incorporation, Daegu 41519, Korea

Correspondence to:Oh-Deog Kwon
E-mail: odkwon@knu.ac.kr
https://orcid.org/0000-0002-2538-5803

Choi-Kyu Park
E-mail: parkck@knu.ac.kr
https://orcid.org/0000-0002-0784-9061

These first two authors contributed equally to this work.

Received: March 4, 2024; Revised: March 11, 2024; Accepted: March 12, 2024

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Feline bocavirus (FBoV) is considered an emerging pathogen recently identified in domestic cats worldwide. To date, three species of FBoVs (FBoV-1, FBoV-2, and FBoV-3) have been reported, but there are no reports identifying FBoVs in Korea. In this study, we detected novel FBoVs for the first time in Korea in captive wild felids (four European lynx and a lion) kept at Seoul Zoo. In FBoV-positive fecal samples, not only singular infections but also dual or triple infections with three different species of FBoVs were confirmed, suggesting that three species of FBoVs are already introduced and co-circulated in susceptible host animals in Korea. These results will help expand our understanding of the geographical distribution and host susceptibility of novel FBoVs. Further studies are necessary to determine the infection status of FBoVs in domestic cats and the genetic characteristics of the viruses circulating in Korea.

Keywords: Feline bocavirus, Molecular screening, European lynx, Lion, Korea

INTRODUCTION

Parvoviruses in the family Parvoviridae are currently classified into three subfamilies, Densovirinae, Parvovirinae, and Hamaparvovirinae, members of which infect non-vertebrate, vertebrate, and both non-vertebrate and vertebrate hosts, respectively. The subfamily Parvovirinae is divided into eleven genera based on the recently revised taxonomy: Amdoparvovirus, Artiparvovirus, Aveparvovirus, Bocaparvovirus, Copiparvovirus, Dependoparvovirus, Erythroparvovirus, Loriparvovirus, Protoparvovirus, Sandeparvovirus, and Tetraparvovirus (Cotmore et al, 2019; Pénzes et al, 2020). Bocavirus (BoV), belonging to the genus Bocaparvovirus within the subfamily Parvovirinae, is considered an emerging pathogen and has been detected in a wide range of hosts, including humans, cats, cows, pigs, gorillas, chimpanzees, California sea lion, rabbits, Himalayan marmots, camels, wild boars, bats, minks, house shrews, Amur leopard cat, Eastern roe deer, and rodents (Aryal and Liu, 2021; Liu et al, 2022; Sun et al, 2023). Currently, members of BoV are classified into thirty-one species based on the ICTV classification criteria: Bocaparvovirus carnivoran1 to 7, Bocaparvovirus chiropteran1 to 5, Bocaparvovirus incertum1, Bocaparvovirus largomorph1, Bocaparvovirus pinniped1 and 2, Bocaparvovirus primate1 to 3, Bocaparvovirus rodent1 to 3, and Bocaparvovirus ungulate1 to 9. Among these, Bocaparvovirus carnivoran3, 4, and 5, also known as feline bocavirus 1 (FBoV-1), FBoV-2, and FBoV-3, have been founded in domestic cats with variable clinical signs (Capozza et al, 2021; ICTV, 2024).

FBoV was first identified from stray cats in Hong Kong in 2012 (Lau et al, 2012), and then designated as a species named Bocaparvovirus carnivoran3, according to the new strict classification criteria of ICTV (Cotmore et al, 2019; Pénzes et al, 2020). FBoV-2 was subsequently discovered in the feces of a single healthy cat from Portugal (Ng et al, 2014). The detected FBoV-2 POR1 strain was genetically distinct from FBoV-1 strains previously identified in Hong Kong and now classified as a different species, Bocaparvovirus carnivoran4. FBoV-3 was detected in fecal samples collected from sheltered cats in the United States in 2014 and was classified as the third FBoV (species Bocaparvovirus carnivoran5) because it showed low amino acid homology to previously identified FBoV-1 and FBoV-2 (Zhang et al, 2014). Since then, these three species of FBoVs have been identified in cats with and without clinical signs in several countries, including Europe, China, Japan, Thailand, Canada, and Australia, suggesting that genetically and biologically different FBoVs are spreading in cat populations around the world (Ng et al, 2014; Takano et al, 2016; Liu et al, 2018; Yi et al, 2018; Piewbang et al, 2019; Li et al, 2020; Van Brussel et al, 2022).

To date, BoV infections have been reported in humans (Chung et al, 2006), pigs (Choi et al, 2014; Yoo et al, 2015), and dogs (Choi et al, 2015; Koh et al, 2020) in Korea, but have not been reported in domestic cats and wild felids. In this study, molecular screening was carried out with fecal samples collected from five species of captured wild felids to identify novel FBoVs in Korea. These results will help expand our knowledge of epidemiology and virology of FBoVs in Korea.

MATERIALS AND METHODS

Clinical samples

A total of 35 fecal samples were collected from five different species of wild felids, including four Eurasian lynxes (Lynx lynx), twelve leopard cats (Prionailurus bengalensis), eleven Siberian tigers (Panthera tigris), three leopards (Panthera pardus), and five lions (Panthera reo) in the Seoul Zoo in 2024. All animals were clinically healthy without any clinical signs suspected with enteric diseases at the time of sample collection. The collected samples were stored at −80℃ until processing. The samples to be used in this study were collected by veterinarians at the Seoul Zoo without any animal contact, ethical approval from our institute regarding the animals was not required.

Nucleic acid extraction

Each collected fecal sample was immersed in 1 mL of phosphate-buffered saline (0.15 M, pH 7.2) and then centrifuged at 3000 × g for 10 min. Then, supernatants were aliquoted and stored at −80℃ for further analysis. Total nucleic acids were extracted from the 200 uL of collected swab samples using a TANBead Nucleic Acid Extraction Kit with a fully automated magnetic bead operating platform (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan), according to the manufacturer’s directions. The extracted nucleic acids were allocated and stored at −80℃ until further use.

Molecular screening of feline bocaparvoviruses

Molecular screening for three species of FBoVs (FBoV-1, FBoV-2, and FBoV-3) was carried out with SYBR Green-based real-time quantitative polymerase chain reaction (qPCR) assays using each virus-specific primer and a commercial qPCR kit [RealHelixTM qPCR kit (Green), NanoHelix, Daejeon, Republic of Korea] according to the manufacturer’s instructions. Previously described primers for FBoV-1 (Lau et al, 2012), FBoV-2 (Ng et al, 2014), and FBoV-3 (Zhang et al, 2014) were used in the qPCR assays (Table 1). The qPCR program was identical to the following conditions: initial denaturation at 95℃ for 15 min, followed by 40 cycles at 95℃ for 15 s, and 60℃ for 60 s for amplification. Fluorescence signals generated by SYBR Green dye for tested samples were measured at the end of each annealing step and the cycle threshold (Ct) values for each sample were calculated by determining the point at which the fluorescence exceeded the threshold limit. To interpret the qPCR results, samples with a Ct value of less than 37 were considered positive, whereas those with Ct values of higher than 37 were considered negative.

Table 1 . Primers used in real-time PCR assay for screening of feline bocaparvoviruses (FBoV) in this study.

PathogenPrimerSequence (5’–3’)Amplicon size (bp)Reference
FBoV-1FBoV1F
FBoV1R
TCTACAAGTGGGACATTGGA
GAGCTTGATTGCATTCACGA
133Lau et al (2012)
FBoV-2FBoV2AF
FBoV2AR
TCGTTCGTCTTGGAACATAGC
CAGAGCGTGGATCTGTCTGA
331Ng et al (2014)
FBoV-3FBD1L2
FBD1R2
CAAAGGATCGGGAGCGGGCG
TGCCCATGGTGTTGTGATTCCTATCCA
388Zhang et al (2014)

RESULTS AND DISCUSSION

In this study, we conducted molecular screening of feline infectious viral pathogens as part of disease monitoring on wild felids raised in the Seoul Zoo. Through this, we were fortunate to confirm that European lynx and lion in the zoo were exposed to novel FBoVs. All three species of FBoV DNAs were detected from five fecal samples collected from four European lynxes and a lion (Table 2). FBoV-1 DNAs were detected from all four fecal samples of European lynxes, FBoV-2 DNAs were detected from two fecal samples of a European lynx and a lion, and FBoV-3 DNAs were detected from three fecal samples from two European lynx and a lion, respectively (Table 2, Fig. 1). Furthermore, co-infection of FBoV-1, FBoV-2, and/or FBoV-3 also was identified in the FBoV-positive samples in this study (Table 3). These results showed that three species of FBoVs have already been introduced in Korea and are infected in some captive wild felids such as European lynx and lion as determined in this study.

Table 2 . Molecular detection of feline bocaparvoviruses (FBoV) in fecal samples of captive wild felids.

SpeciesCommon nameNo. of samplesDetection of FBoV (No. of positive)
FBoV-1FBoV-2FBoV-3
Lynx lynxEurasian lynx4412
Prionailurus bengalensisLeopard cat12000
Panthera tigrisSiberian tiger11000
Panthera pardusLeopard3000
Panthera reoLion5011
Total35423


Table 3 . Details of diagnostic results for feline bocaparvovirus (FBoV)-positive samples.

SpeciesSample IDResults of real-time PCR assay (Ct value)
FBoV-1FBoV-2FBoV-3
Lynx lynx (European lynx)LL127.81-33.33
LL234.00--
LL328.2334.6234.93
LL436.06--
Panthera reo (Lion)PR4-33.3633.46

-, negative results (>37 of Ct value).



Figure 1. Amplification curve of real-time PCR assay for feline bocaparvoviruses from wild felids. The positive signals of real-time PCR assay for feline bocaparvovirus 1 (FBoV-1) (A), FBoV-2 (B), and FBoV-3 (C) were generated with five fecal samples obtained from four European lynxes (Lynx lynx) and a lion (Panthera reo). Detailed information of positive samples is provided in Table 3.

As an apex predator, the Eurasian lynx (Lynx lynx) and lion (Panthera reo) play important and unique roles in the natural functioning of ecosystems. These two species have been listed as “Least Concern” or “Critically Endangered” species on the International Union for the Conservation of Nature (IUCN) Red List, respectively (Ripple et al, 2014). Despite the efforts for species conservation, the life of the endangered feline species is threatened by some feline infectious pathogens worldwide. Previous studies showed that wild lynxes and lions are susceptible to several feline viral pathogens such as feline parvovirus, feline herpesvirus, feline calicivirus, feline leukemia virus, feline immunodeficiency virus, and canine distemper virus (Schmidt-Posthaus et al, 2002; Ramsauer et al, 2007; Meli et al, 2009; Roelke et al, 2009; Wasieri et al, 2009; Lane et al, 2016; Weckworth et al, 2020; Nájera et al, 2021; Ryser-Degiorgis et al, 2021). However, there have been few studies on the infectious viral disease in captive European lynx and lions in Korea. The finding in this study that FBoV DNAs were identified in fecal samples of European lynx and lion helps to expand our knowledge about the host range of the novel FBoVs and its epidemiology in wild felids.

The origin and transmission route of FBoVs detected in the lynxes and lion are unknown in this study. However, considering that interspecies transmission of feline pathogens between domestic cats and captive wild felids has been frequently reported in several countries, including Korea (Meli et al, 2009; Weckworth et al, 2020; Sacristán et al, 2021; Yeo et al, 2023), the FBoVs detected in wild felids in this study is presumed to have been transmitted from infected domestic cats. In this regard, it is worth noting a previous report that Siberian tigers at this zoo were infected with FPV due to cross-species transmission between tigers and stray cats roaming the zoo (Yeo et al, 2023). However, there are no studies on FBoV infections in the Korean domestic cat population yet. Therefore, further studies are urgently needed to investigate the infection status of FBoVs in Korean domestic cats.

Despite the wide distribution of the three species of FBoVs, co-infection cases of FBoV-1, FBoV-2, and/or FBoV-3 have been rarely reported in domestic cats (Ng et al, 2014; Takano et al, 2016; Liu et al, 2018; Piewbang et al, 2019; Li et al, 2020; Van Brussel et al, 2022). In a recent study carried out in China, co-infection cases of FBoV-1 and FBoV-2 were reported in domestic cats, although the co-infection rate of FBoV-1 and FBoV-2 was much lower than that of singular infection of FBoV-1 or FBoV-2 (Yi et al, 2018). Therefore, the co-infection status of three FBoVs was investigated by using each species-specific monoplex qPCR assays in this study. Of the five FBoV-positive samples, two were singularly infected with FBoV-1 (sample ID LL2 and LL4), but two were dually infected with FBoV-1 and FBoV-3 (sample ID LL1) or FBoV-2 and FBoV-3 (sample ID PR4). Surprisingly, one fecal sample collected from a Eurasian lynx (sample ID LL3) was triply infected with all three species of FBoVs (Table 3, Fig. 1). These results suggested that co-infections of two of three different species of FBoVs frequently occur in susceptible host populations. In this regard, more advanced multiplex qPCR assays are required for simultaneous and differential detection of three species of FBoVs from clinical samples in a single reaction.

There are some limitations in this study. First, viral sequence analysis is important to characterize the Korean FBoVs detected in this study. However, our efforts for genetic sequencing of the detected FBoVs failed in this study due to the low viral loads (high Ct values) in the FBoV-positive clinical samples as shown in Table 3 and Fig. 1. Therefore, further studies are needed to elucidate the genetic characteristics of Korean FBoVs and their relationship with other FBoV strains reported in foreign countries. Second, the molecular screening of FBoVs in this study confirmed that the viruses are infected in susceptible wild felids in a Korean zoo, suggesting that the viruses might be circulating in the Korean domestic cat population. However, surveillance of the viruses in Korean domestic cats was not included in the scope of this study. Therefore, further epidemiological studies are required to investigate the infection status of FBoVs in the Korean domestic cat population. Furthermore, considering that various viral and bacterial pathogens are commonly co-infected in the cat population in Korea (Koh et al, 2020; Kim et al, 2022; Baek et al, 2023a; Baek et al, 2023b), further epidemiological studies are necessary to determine the co-infection status of the novel FBoV and other feline pathogens in Korean cat population.

In conclusion, we confirmed that three species of FBoVs were infected in two species of wild felids (Lynx lynx and Panthera reo) in this study. To the best of our author’s knowledge, this is the first report on the detection of noble FBoVs from captive wild felids in Korea. These results will contribute to expanding our understanding of the geographical distribution and host susceptibility of the novel FBoVs. Further studies are necessary to investigate the infection status of FBoVs in domestic cats and the genetic characteristics of the viruses circulating in Korea.

ACKNOWLEDGEMENTS

This work was supported by the research grants from the Animal and Plant Quarantine Agency (Project No. Z-1543085-2022-23-03), Ministry of Agriculture, Food and Rural Affairs (MAFRA), Republic of Korea.

ETHICS STATEMENT

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study was conducted in 2024 and was beyond the purview of the Institutional Animal Care and Use Committee (IACUC) at Kyungpook National University (KNU), as the KNU IACUC only evaluates proposals using laboratory animals maintained in indoor facilities and not research involving outdoor animals. The fecal samples from captive wild animals were collected by veterinarians working at Seoul Zoo’s veterinary clinic without any restraint on the wild animals.

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

Fig 1.

Figure 1.Amplification curve of real-time PCR assay for feline bocaparvoviruses from wild felids. The positive signals of real-time PCR assay for feline bocaparvovirus 1 (FBoV-1) (A), FBoV-2 (B), and FBoV-3 (C) were generated with five fecal samples obtained from four European lynxes (Lynx lynx) and a lion (Panthera reo). Detailed information of positive samples is provided in Table 3.
Korean Journal of Veterinary Service 2024; 47: 41-48https://doi.org/10.7853/kjvs.2024.47.1.41

Table 1 . Primers used in real-time PCR assay for screening of feline bocaparvoviruses (FBoV) in this study.

PathogenPrimerSequence (5’–3’)Amplicon size (bp)Reference
FBoV-1FBoV1F
FBoV1R
TCTACAAGTGGGACATTGGA
GAGCTTGATTGCATTCACGA
133Lau et al (2012)
FBoV-2FBoV2AF
FBoV2AR
TCGTTCGTCTTGGAACATAGC
CAGAGCGTGGATCTGTCTGA
331Ng et al (2014)
FBoV-3FBD1L2
FBD1R2
CAAAGGATCGGGAGCGGGCG
TGCCCATGGTGTTGTGATTCCTATCCA
388Zhang et al (2014)

Table 2 . Molecular detection of feline bocaparvoviruses (FBoV) in fecal samples of captive wild felids.

SpeciesCommon nameNo. of samplesDetection of FBoV (No. of positive)
FBoV-1FBoV-2FBoV-3
Lynx lynxEurasian lynx4412
Prionailurus bengalensisLeopard cat12000
Panthera tigrisSiberian tiger11000
Panthera pardusLeopard3000
Panthera reoLion5011
Total35423

Table 3 . Details of diagnostic results for feline bocaparvovirus (FBoV)-positive samples.

SpeciesSample IDResults of real-time PCR assay (Ct value)
FBoV-1FBoV-2FBoV-3
Lynx lynx (European lynx)LL127.81-33.33
LL234.00--
LL328.2334.6234.93
LL436.06--
Panthera reo (Lion)PR4-33.3633.46

-, negative results (>37 of Ct value).


References

  1. Aryal M and Liu G. 2021. Porcine bocavirus: A 10-year history since its discovery. Virol Sin 36(6):1261-1272.
    Pubmed KoreaMed CrossRef
  2. Baek JS, Kim JM, Kim HR, Park JH, Shin YK, Kang HE, Kwon JH, Lee WJ, Jang M, Lee SK, Cho HS, Oh Y, Park CK. 2023a. Development and evaluation of a triplex real-time quantitative reverse transcription-polymerase chain reaction for rapid and differential detection of three feline respiratory viral pathogens. Korean J Vet Serv 46(4):269-281.
    CrossRef
  3. Baek JS, Kim JM, Kim HR, Shin YK, Kwon OK, Park CK. 2023b. Prevalence of feline calicivirus in Korean cats determined by an improved real-time RT-PCR assay. Korean J Vet Serv 46(2):123-135.
    CrossRef
  4. Capozza P, Martella V, Decaro N. 2021. Emerging parvoviruses in domestic cats. Viruses 2021 13(6):1077.
    Pubmed KoreaMed CrossRef
  5. Choi JW, Lee KH, Lee JI, Lee MH, Oem JK. 2015. Genetic characteristics of canine bocaviruses in Korean dogs. Vet Microbiol 179(3-4):177-183.
    Pubmed KoreaMed CrossRef
  6. Choi MG, Park SJ, Nguyen VG, Chung HC, Park BK. 2014. Molecular detection and genetic analysis of porcine bocavirus in Korean domestic swine herds. Arch Virol 159(6):1487-1492.
    Pubmed CrossRef
  7. Chung JY, Han TH, Kim SW. 2006. Bocavirus infection in hospitalized children, South Korea. Emerg Infect Dis 12(8):1254-1256.
    Pubmed KoreaMed CrossRef
  8. Cotmore SF, Agbandje-McKenna M, Canuti M, Chiorini JA, Eis-Hubinger AM, Hughes J, Mietzsch M, Modha S, Ogliastro M, Pénzes JJ, Pintel DJ, Qiu J, Soderlund-Venermo M, Tijssen P; Ictv Report Consortium. 2019. ICTV Virus Taxonomy Profile: Parvoviridae. J Gen Virol 100(3):367-368.
    Pubmed KoreaMed CrossRef
  9. ICTV, International Committee on Taxonomy of Viruses. [(accessed on 5 January 2024)]; Available online: https://talk.ictvonline.org/ictv-reports/ictv_online_report/ssdna-viruses/w/parvoviridae.
  10. Kim HR, Jeon GT, Kim JM, Baek JS, Shin YK, Kwon OK, Kang HE, Cho HS, Park CK. 2022. Prevalence of Bordetella bronchiseptica, Mycoplasma felis, and Chlamydia felis using a newly developed triplex real-time polymerase chain reaction assay in Korean cat population. Korean J Vet Serv 45(4):305-316.
    CrossRef
  11. Koh BRD, Kim HN, Kim HJ, Oh AR, Jung BR, Park JS, Lee JG, Kim YH. 2020. A survey of respiratory pathogens in dogs for adoption in Gwangju metropolitan city animal shelter, South Korea. Korean J Vet Serv 43(2):67-77.
  12. Lane EP, Brettschneider H, Caldwell P, Oosthuizen A, Dalton DL, du Plessis L, Kotze A. 2016. Feline panleukopaenia virus in captive non-domestic felids in South Africa. Onderstepoort J Vet Res 83(1):a1099.
    Pubmed KoreaMed CrossRef
  13. Lau SKP, Woo PCY, Yeung HC, Teng JLL, Wu Y, Bai R, Fan RYY, Yuen KY. 2012. Identification and characterization of bocaviruses in cats and dogs reveals a novel feline bocavirus and a novel genetic group of canine bocavirus. J Gen Virol 93(7):1573-1582.
    Pubmed CrossRef
  14. Li Y, Gordon E, Idle A, Altan E, Seguin MA, Estrada M, Delwart E. 2020. Virome of a feline outbreak of diarrhea and vomiting includes Bocaviruses and a novel Chapparvovirus. Viruses 12(5):506.
    Pubmed KoreaMed CrossRef
  15. Liu C, Liu F, Li Z, Liu D. 2018. First report of feline bocavirus associated with severe enteritis of cat in Northeast China, 2015. J Vet Med Sci 80(4):731-735.
    Pubmed KoreaMed CrossRef
  16. Liu Y, Sun L, Tu Z, Sun S, Sun Y, Yi L, He B. 2022. Virome profiling of an Amur leopard cat reveals multiple Anelloviruses and a Bocaparvovirus. Vet Sci 9(11):640.
    Pubmed KoreaMed CrossRef
  17. Meli ML, Cattori V, Martínez F, López G, Vargas A, Simón MA, Zorrilla I, Muñoz A, Palomares F, López-Bao JV, Pastor J, Tandon R, Willi B, Lutz H. 2009. Feline leukemia virus and other pathogens as important threats to the survival of the critically endangered Iberian lynx (Lynx pardinus). PLoS One 4(3):e4744.
    Pubmed KoreaMed CrossRef
  18. Nájera F, Grande-Gómez R, Peña J, Vázquez A, Palacios MJ, Rueda C, Corona-Bravo AI, Zorrilla I, Revuelta L, Jiménez J. 2021. Disease surveillance during the reintroduction of the Iberian lynx (Lynx pardinus) in Southwestern Spain. Animals 11:547.
    Pubmed KoreaMed CrossRef
  19. Ng TF, Mesquita JR, Nascimento MS, Kondov NO, Wong W, Reuter G, Knowles NJ, Vega E, Esona MD, Deng X, Delwart E. 2014. Feline fecal virome reveals novel and prevalent enteric viruses. Vet Microbiol 171(1-2):102-111.
    Pubmed KoreaMed CrossRef
  20. Pénzes JJ, Söderlund-Venermo M, Canuti M, Eis-Hübinger AM, Hughes J, Harrach B. 2020. Reorganizing the family Parvoviridae: a revised taxonomy independent of the canonical approach based on host association. Arch Virol 165(9):2133-2146.
    Pubmed CrossRef
  21. Piewbang C, Kasantikul T, Techangamsuwan S. 2019. Feline bocavirus-1 associated with outbreaks of hemorrhagic enteritis in household cats: potential first evidence of a pathological role, viral tropism and natural genetic recombination. Sci Rep 9(1):16367.
    Pubmed KoreaMed CrossRef
  22. Ramsauer S, Bay G, Meli M, Lutz H. 2007. Seroprevalence of selected infectious agents in a free-ranging, low-density lion population in the Central Kalahari Game Reserves in Botswana. Clin Vaccine Immunol 14(6):808-810.
    Pubmed KoreaMed CrossRef
  23. Ripple WJ, Estes JA, Beschta RL, Wilmers CC, Ritchie EG, Hebblewhite M, Berger J, Elmhagen B, Letnic M, Nelson MP, Schmitz OJ, Smith DW, Wirsing AJ. 2014. Status and ecological effects of the world's largest carnivores. Science 343(6167):1241484.
    Pubmed CrossRef
  24. Roelke ME, Brown MA, Troyer JL, Winterbach H, Winterbach C, Hemson G, Smith D, Johnson RC, Pecon-Slattery J, Roca AL, Alexander KA, Klein L, Martelli P, O'Brien SJ. 2009. Pathological manifestations of feline immunodeficiency virus (FIV) infection in wild African lions. Virology 390(1):1-12.
    Pubmed KoreaMed CrossRef
  25. Ryser-Degiorgis MP, Marti I, Pisano SRR, Pewsner M, Wehrle M, Breitenmoser-Würsten C, Origgi FC, Kübber-Heiss A, Knauer F, Posautz A, Eberspächer-Schweda M, Huder JB, Böni J, Kubacki J, Bachofen C, Riond B, Meli ML. 2021. Management of suspected cases of feline immunodeficiency virus infection in Eurasian lynx (Lynx lynx) during an international translocation program. Front Vet Sci 8:730874.
    Pubmed KoreaMed CrossRef
  26. Sacristán I, Acuña F, Aguilar E, García S, José López M, Cabello J, Hidalgo-Hermoso E, Sanderson J, Terio KA, Barrs V, Beatty J, Johnson WE, Millán J, Napolitano C. 2021. Cross-species transmission of retroviruses among domestic and wild felids in human-occupied landscapes in Chile. Evol Appl 14(4):1070-1082.
    Pubmed KoreaMed CrossRef
  27. Schmidt-Posthaus H, Breitenmoser-Würsten C, Posthaus H, Breitenmoser U. 2002. Causes of mortality in reintroduced Eurasian lynx in Switzerland. J Wildl Dis 38(1):84-92.
    Pubmed CrossRef
  28. Sun Y, Sun L, Sun S, Tu Z, Liu Y, Yi L, He B. 2023. Virome profiling of an Eastern roe deer reveals spillover of viruses from domestic animals to wildlife. Pathogens 12(2):156.
    Pubmed KoreaMed CrossRef
  29. Takano T, Takadate Y, Hohdatsu T. 2016. Genetic characterization of feline bocavirus detected in cats in Japan. Arch Virol 161(10):2825-1828.
    Pubmed KoreaMed CrossRef
  30. Van Brussel K, Wang X, Shi M, Carrai M, Feng S, Li J, Holmes EC, Barrs VR. 2022. The enteric virome of cats with feline panleukopenia differs in abundance and diversity from healthy cats. Transbound Emerg Dis 69(5):e2952-e2966.
    Pubmed KoreaMed CrossRef
  31. Wasieri J, Schmiedeknecht G, Förster C, Reinacher M. 2009. Parvovirus infection in a Eurasian lynx (Lynx lynx) and in a European wildcat (Felis silvestris silvestris). J Comp Pathol 140(2-3):203-207.
    Pubmed CrossRef
  32. Weckworth JK, Davis BW, Dubovi E, Fountain-Jones N, Packer C, Cleaveland S, Craft ME, Eblate E, Schwartz M, Roelke-Parker M. 2020. Cross-species transmission and evolutionary dynamics of canine distemper virus during a spillover in African lions of Serengeti National Park. Mol Ecol 29(22):4308-4321.
    Pubmed CrossRef
  33. Yeo YG, Kim HR, Park J, Kim JM, Shin YK, Lee KK, Kwon OK, Jeoung HY, Kang HE, Ku BK, Park SC, Park CK. 2023. Epidemiological and molecular approaches for a fatal feline panleukopenia virus infection of captive Siberian tigers (Panthera tigris altaica) in the Republic of Korea. Animals (Basel) 13(18):2991.
    Pubmed KoreaMed CrossRef
  34. Yi S, Niu J, Wang H, Dong G, Zhao Y, Dong H, Guo Y, Hu G. 2018. Detection and genetic characterization of feline bocavirus in Northeast China. Virol J 15(1):125.
    Pubmed KoreaMed CrossRef
  35. Yoo SJ, Sunwoo SY, Ko SS, Je SH, Lyoo YS. 2015. A novel porcine bocavirus harbors a variant NP gene. Springerplus. 4:370.
    Pubmed KoreaMed CrossRef
  36. Zhang W, Li L, Deng X, Kapusinszky B, Delwart E. 2014. Faecal virome of cats in an animal shelter. J Gen Virol 95(11):2553-2564.
    Pubmed KoreaMed CrossRef
KJVS
Mar 30, 2024 Vol.47 No.1, pp. 1~7

Stats or Metrics

Share this article on

  • line

Related articles in KJVS

Korean Journal of
Veterinary Service

eISSN 2287-7630
pISSN 1225-6552
qr-code Download