Top
Search 닫기

Original Article

Split Viewer

Korean J. Vet. Serv. 2024; 47(1): 27-33

Published online March 30, 2024

https://doi.org/10.7853/kjvs.2024.47.1.27

© The Korean Socitety of Veterinary Service

대구지역 도축장 출하가축의 도체에서 분리한 Staphylococcus aureus의 항생제 내성과 MRSA 검출에 관한 연구

임현숙*ㆍ서동균ㆍ김환득ㆍ이혜화ㆍ김정미ㆍ임미하ㆍ조재근

대구광역시 보건환경연구원

Received: January 23, 2024; Revised: March 8, 2024; Accepted: March 9, 2024

Study on antimicrobial resistance and detection of MRSA of Staphylococcus aureus isolated from carcass in Daegu slaughterhouses

Hyun-Sook Lim *, Dong-Keun Suh , Hwan-Deuk Kim , Hye-Hwa Lee , Jeong-Mi Kim , MiHa Im , Jae-Keun Cho

Metropolitan Health & Environmental Research Institute, Daegu 42183, Korea

Correspondence to : Hyun-Sook Lim
E-mail: hyunsooki@korea.kr
https://orcid.org/0000-0002-1701-3241

Received: January 23, 2024; Revised: March 8, 2024; Accepted: March 9, 2024

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

At the present study, it was aimed to explore the states of antimicrobial resistant Staphylococcus aureus isolates from 1,360 chickens, pigs and cattle carcass (400 chickens, 480 pigs and 480 cattle) in Daegu province from January 2022 to December 2022. Among 1,360 samples, 81 of S. aureus were isolated cattle (1.4%), pigs (7.7%) and chickens (9.2%). In antimicrobial susceptibility test, all of the isolates were demonstrated susceptibility to rifampin. But the isolates were showed resistance other antibiotics in order of tetracycline (62.9%), ciprofloxacin (62.9%), tobramycin (58.0%), gentamicin (51.8%), amikacin (40.7%), penicillin (39.5%), clindamycin (35.8%), enrofloxacin (33.3%), trimethoprim/sulfamethoxazole (30.8%), oxacillin (30.8%), minocycline (29.6%), erythromycin (25.9%), quinupristin/dalfopristin (20.9%), chloramphenicol (12.3%), cefoxitin (9.8%). Among the 81 S. aureus isolates, 25 (30.8%) methicillin-resistant staphylococcus aureus (MRSA) were observed. Seven (28.0%) of 25 MRSA harbored mecA gene. About 96% of MRSA were multidrug resistance to at least 3 more drugs. A continuous monitoring and surveillance program to prevent antimicrobial resistance in livestock products is demanded.

Keywords Staphylococcus aureus, MRSA, Antibiotics susceptibility

항생제 내성은 신종 코로나바이러스감염증(코로나19) 팬데믹 이후 인류에게 발생하는 가장 큰 위기로 꼽히고 있다. 세계적으로 항생제 내성균으로 사망하는 사람이 현재는 연간 약 70 만명으로 추정되고 있으며, 내성 문제를 이대로 방치하면 2050년에는 약 1000 만명으로 증가할 것으로 추정한다(Kim, 2020).

축산분야의 항생제 내성은 직·간접적으로 사람에게 전파될 가능성이 있으며, 산업동물에서의 항생제 사용으로 유발되는 사람에서 위해는 다음과 같이 두 가지 방법에 따라 발생할 수 있다(McEween과 Reid-Smith, 2004; McDermott 등, 2022).

첫째 축산식품에 항생제가 잔류하여 잔류항생제의 섭취로 사람에게 독성이 발생하거나 사람의 공생균에 내성이 유도될 수 있다. 두 번째로는 산업동물에 사용되는 항생제로 인해 산업동물에서 항생제 내성균이 발생하고, 축산식품의 섭취를 통해 항생제 내성균 또는 내성인자가 사람에 전파되는 것이다.

이러한 이유로 전 세계적으로 항생제 내성균 모니터링 시스템의 필요성이 대두되어 국내 축산분야에서는 2003년부터 농림축산검역본부에서 단독으로 추진해오다가 전국적인 수준의 국가 차원 시스템 구축의 필요성을 인식하고 2008년부터는 전국 동물위생시험소 및 보건환경연구원에서 참여하는 축산 항생제 내성균 감시체계 구축 사업으로 확대되었다. 본 사업에서는 생산단계 가축 및 도체와 반려동물을 대상으로 지표세균, 식중독 세균, 동물 병원성 세균에 대한 항생제 내성을 조사하고 있다(농림축산검역본부, 2022b). 생산단계 가축의 도체와 분변에서 지표세균인 E. coli, E. faecium, E. faecalis, 식중독 세균인 Salmonella spp. C. jejuni/coli, S. aureus를 모니터링하고 있다. 그 중 S. aureus는 그람 양성 구균으로 자연계에 널리 분포하고 있으며, 사람과 동물의 피부에 상재하는 정상 세균이지만, 적당한 환경조건이 주어지면 여러 가지 질병을 일으키는 기회 감염균이다. 황색 색소를 생산하고 혈액배지에서 용혈성을 나타내며, 병원성이 강하고, 조직 침습성이 높아 사람과 동물에 농가진, 농양, 봉와직염 등의 피부감염증, 창상감염, 골수염, 경부림프선염, 식중독, 폐렴, 패혈증 및 뇌수막염 등의 감염증을 일으키는 것으로 알려져 있다(Timoney 등, 1988; Davis 등, 1990). S. aureus로 인한 여러 가지 질병을 치료하기 위해 광범위 항생제의 무분별한 사용으로 내성균이 출현하였고, 특히 다제내성균이 급격히 증가하여 사람과 동물의 치료에 많은 어려움이 있는 실정이다(Frost와 O’Boyle, 1981; Carven, 1986; Myllys 등, 1998).

S. aureus는 다른 균에 비해 내성 획득 속도가 빠르고, 주로 β-lactamase를 생성하여 β-lactam계열의 항생제에 내성을 가지며, plasmid를 통해 전달되어 다른 항균제 내성과 동반하기도 한다. β-lactamase에 의해 가수분해를 받지 않는 반합성 페니실린계인 methicillin이 S. aureus의 감염 치료에 이용되고부터 methicillin에 고도 내성인 methicillin-resistant staphylococcus aureus (MRSA)가 출현하여 병원 내 감염의 주요한 원인균으로 알려져 왔다(이연희, 1998; 송재훈, 1998).

따라서 본 연구의 목적은 대구지역 도축장 출하 가축의 도체에서 S. aureus를 분리하여 항생제 내성 양상과 MRSA의 존재 여부를 파악하여 S. aureus의 내성 확산 방지와 사람과 동물 간의 상호감염에 대한 기초자료를 확보하고자 한다.

균분리 및 동정

2022년 1월부터 2022년 12월까지 대구지역 도축장 및 도계장에서 출하하는 소 480두, 돼지 480두, 닭 400수를 대상으로 식육 도체 표면에서 시료를 채취하였다. 소 및 돼지 도체는 표면(10×10 cm)의 3개 부위에서 채취하고, 닭의 도체는 1마리 전체를 대상으로 채취하여 검사하였다. 증균배양은 도체 현탁액 Buffered Peptone Water (BPW) 1 mL를 6.5% NaCl을 첨가한 tryptic soy broth에서 37℃, 16시간 배양하였다. 배양액 50 µL를 CHROMagar-Staph. aureus에 접종 후, 37℃, 16시간 배양하였다. 전형적인 집락을 선택해서 blood agar에 접종 후 37℃, 16시간 배양하였고, β-hemolysis 현상이 일어나는 균을 nutrient agar에 접종하여 37℃, 16시간 배양함과 동시에 coagulase test를 실시하여 양성임을 확인하였다.

Genomic DNA 추출

공시균에 대한 genomic DNA 추출은 boiling 법으로 실시하였다. 우선 tryptic soy broth (Oxoid, UK)에 접종하여 37℃에서 18∼24시간 진탕 배양하여 얻은 균 부유액 1 mL를 13,000 rpm에서 2분간 원심분리한 후 상층액을 제거한 다음 멸균 증류수 0.5 mL로 재부유 하였다. 부유액은 끓는 물에 10분간 가열한 다음 13,000 rpm에서 10분간 원심분리한 후 상층액을 취하여 template DNA로 사용하였다.

PCR에 의한 S. aureus 확인시험

S. aureus의 최종 확인은 Real-time PCR (7500 fast real time systems, Applied biosystems)을 이용하였다. PowerCheck staphylococcus aureus Real-time PCR kit (코젠바이오텍)를 사용하였으며, 추출한 template DNA 5 µL를 staphylococcus aureus Real-time PCR premix에 첨가해 총 20 µL 되게 하여 7500 fast real time systems으로 실험을 수행하였다.

항생제 감수성 시험

항균제 감수성 시험은 Clinical and Laboratory Standards Institute의 기준(2017)에 따라 디스크 확산법으로 실시하였다. 항생제 디스크는 Oxoid사(UK)의 oxacillin (1 µg, OX), cefoxitin (30 µg, FOX), penicillin (10 UI, PC), gentamicin (10 µg, GM), amikacin (30 µg, AN), tobramycin (10 µg, TB), erythromycin (15 µg, EM), tetracycline (30 µg, TC), minocycline (30 µg, MC), ciprofloxacin (5 µg, CIP), enrofloxacin (10 µg, ENR), clindamycin (2 µg, DA), trimethoprim/sulfamethoxazole (1.25/23.75 µg, SXT), chloramphenicol (30 µg, CM), rifampin (5 µg, RD), quinupristin/dalfopristin (15 µg, QD) 등 16종을 공시하였다. S. aureus는 OX에 내성인 균주를 MRSA로 판정하였다.

약제내성 유전자(mecA) 검출

약제내성 유전자(mecA)의 검출은 PCR을 이용하여 이전 연구자들의 방법에 따라 실시하였다(Nakaminami 등, 2020). PCR 반응은 Maxime PCR PreMix (i-StarTag, Intron, Korea)에 각각의 10 pmol primer 1 µL와 template DNA 1 µL를 넣은 후, 멸균된 증류수를 첨가하여 최종 반응량이 20 µL 되게 하여 Tprofessional Thermal Cycler (Biometra, Germany)로 실험을 수행하였다(Table 1). PCR 반응 조건은 predenaturation을 95℃ 5분간 실시 후, denaturation은 94℃에서 30초, annealing은 58℃에서 45초, polymerization은 72℃에서 1분 30초간 총 25 cycle로 증폭하고, 그 후 72℃에서 5분간 post-polymerization을 실시하였다. 증폭된 산물은 자동 전기 영동장치(QIAxcel Advanced System)를 이용하여 확인하였다.

Table 1 . Synthetic oligonucleotides used as primers for PCR

Target geneSequence (5’-3’)Size (bp)Reference
mecATGGCTATCGTGTCACAATCG310Dziva et al, 2015
CTGGAACTTGTTGAGCAGAG

S. aureus의 분리율

소와 돼지, 닭의 도체에서 분리한 S. aureus의 분리율은 Table 2에서와 같이 총 1,360건 중 5.9% (81주)였다. 축종별 분리율은 소에서 1.4% (7주/480건), 돼지에서 7.7% (37주/480건), 닭에서 9.2% (37주/400건)였다.

Table 2 . Isolation rates of S. aureus isolates from cattle, pigs and chickens carcass

AnimalNo. of samples
TestedIsolated (%)
Cattle4807 (1.4)
Pig48037 (7.7)
Chicken40037 (9.2)
Total1,36081 (5.9)


항생제 감수성시험

분리된 S. aureus 81주에 대한 항생제 감수성 시험검사 결과는 Table 3과 같다. 소유래 S. aureus 7주는 FOX, RD은 100% 감수성을 나타내었고, 내성율은 MC 5주(71.4%), QD 3주(42.8%), TC, DA, PC, SXT, OX, ENR, TB, EM은 각 2주(28.5%), CM, AN, GM, CIP은 각 1주(14.2%) 순이었다.

Table 3 . Antimicrobial resistance of 81 S. aureus isolates from cattle, pigs and chickens carcass

Antimicrobial agentNo. of isolates with indicated antimicrobial resistance (%)
Cattle (n=7)Pigs (n=37)Chickens (n=37)Total (n=81)
Cefoxitin08 (21.6%)08 (9.8%)
Tetracycline2 (28.5%)24 (64.8%)25 (67.5%)51 (62.9%)
Clindamycin2 (28.5%)24 (64.8%)3 (8.1%)29 (35.8%)
Penicillin2 (28.5%)28 (75.6%)2 (5.4%)32 (39.5%)
Trimethoprim/sulfamethoxazole2 (28.5%)23 (62.1%)025 (30.8%)
Oxacillin2 (28.5%)23 (62.1%)025 (30.8%)
Quinupristin/dalfopristin3 (42.8%)14 (37.8%)017 (20.9%)
Erythromycin2 (28.5%)19 (51.3%)021 (25.9%)
Chloramphenicol1 (14.2%)9 (24.3%)010 (12.3%)
Minocycline5 (71.4%)18 (48.6%)1 (2.7%)24 (29.6%)
Enrofloxacin2 (28.5%)23 (62.1%)2 (5.4%)27 (33.3%)
Rifampin0000
Amikacin1 (14.2%)22 (59.4%)1 (2.7%)33 (40.7%)
Tobramycin2 (28.5%)29 (78.3%)16 (43.2%)47 (58.0%)
Gentamicin1 (14.2%)22 (59.4%)19 (51.3%)42 (51.8%)
Ciprofloxacin1 (14.2%)23 (62.1%)27 (72.9%)51 (62.9%)


돼지유래 S. aureus 37주는 RD에 대해 100%의 감수성을 나타내었고, 내성율은 TB 29주(78.3%), PC 28주(75.6%), TC과 DA은 각 24주(64.8%), SXT과 OX, ENR, CIP은 각 23주(62.1%), AN, GM은 각 22주(59.4%), EM 19주(51.3%), MC 18주(48.6%), QD 14주(37.8%), CM 9주(24.3%), FOX 8주(21.6%) 순이었다.

닭유래 S. aureus 37주는 FOX, SXT, OX, QD, EM, CM, RD에 대해 100%의 감수성을 나타내었고, 내성율은 CIP 27주(72.9%), TC 25주(67.5%), GM 19주(51.3%), TB 16주(43.2%), DA 3주(8.1%), PC과 ENR은 각 2주(5.4%), MC과 AN은 각 1주(2.7%) 순이었다.

분리한 S. aureus 96.2% (78주)는 사용된 한 종류 이상의 약제에 내성을 나타내었으며, 65.4% (53주)는 3가지 이상 계열의 항생제에 대해 내성을 보인 다약제 내성균이었다(Table 4). 축종별로 보면 소에서 28.5% (2주), 돼지에서 70% (26주), 닭에서 67.5% (25주)의 비율로 다약제 내성률을 나타내었다.

Table 4 . Distribution of multi-drug resistance in 81 S. aureus isolated from cattle, pigs and chickens carcass

No. of antimicrobial classesNo. of resistant isolates (%)
Cattle (n=7)Pigs (n=37)Chickens (n=37)Total (n=81)
311011 (13.5)
421012 (14.8)
555 (6.1)
811 (1.2)
10167 (8.6)
1122 (2.4)
1288 (9.8)
13134 (4.9)
1422 (2.4)
1511 (1.2)
Total2 (28.5)26 (70)25 (67.5)53 (65.4)


MRSA 분리 및 mecA 유전자 검출

본 연구에서 분리된 S. aureus 81주 중 OX에 내성을 보인 MRSA는 소에서 2주, 돼지에서 23주, 닭에서 0주 분리되어 총 25주(30.8%)였다. Methicillin에 내성, 중간내성, 감수성을 보인 균주로 분류하여 mecA 유전자의 보유현황을 조사한 결과는 Table 5와 같다. Methicillin에 내성을 보인 25주 중 mecA 유전자는 돼지에서 분리된 7주(28%)에서만 검출되었다. Methicillin에 중간내성이거나 감수성인 균주에서는 mecA 유전자는 검출되지 않았다.

Table 5 . Distribution of mecA gene in 81 S. aureus isolated from cattle, pigs and chickens

AnimalNo. of isolatesMethicillin-resistant S. aureusMethicillin-intermediate resistant S. aureusMethicillin-susceptible S. aureus
No. of isolatesmecA (+)No. of isolatesmecA (+)No. of isolatesmecA (+)
Cattle7204010
Pig37237 (30.4%)9050
Chicken370050320
Total81257 (28%)180380


본 실험에서 분리된 25균주의 MRSA도 3가지 계열 이상의 항생제에 대해 24균주(96%)가 다약제 내성균으로 확인되었다(Table 6). Methicillin에 감수성이 있는 균주는 23균주(60.5%), 중간내성인 균주는 6균주(33.3%)가 3가지 계열 이상의 다약제 내성균으로 확인되었다. 특히 mecA 유전자가 검출된 균주는 FOX, PC, TC, DA, SXT, ENR, TB, OX에 100% 내성을 보여 다제 내성양상을 보이고, 7균주 모두 10가지 이상의 항생제에 내성을 나타내었다.

Table 6 . Distribution of multi-drug resistance pattern among 81 S. aureus

No. of antimicrobial classesNo. of resistant isolates (%)
Methicillin-resistant S. aureus (n=25)Methicillin-intermediate resistant S. aureus (n=18)Methicillin-susceptible S. aureus (n=38)
32
439
59
65
7
81
9
1061
112
128
134
142
151
Total24 (96.0)6 (33.3)23 (60.5)

본 실험은 2022년 1월부터 12월까지 대구지역 도축장 및 도계장에 출하하는 소, 돼지, 닭의 도체 1,360건을 대상으로 S. aureus 분리율을 조사하였고, S. aureus에 대한 항생제 내성검사를 실시하였다. S. aureus의 분리율은 5.9% (81주/1,360건)이었다. 축종별로 보면 소에서 1.4% (7주/480건), 돼지에서 7.7% (37주/480건), 닭에서 9.2% (37주/400건)이었다. 이 등(2010)이 보고한 소와 돼지 도체표면에서 S. aureus 분리율은 소에서 5.6%, 돼지에서 10.6%였으며, 황 등(2010)이 2003∼2008년 국내 도축장의 동물 도체에서 S. aureus 분리율을 조사한 결과 소에서 9.8%, 돼지에서 18.8%, 닭에서 36.6%로 본 실험이 더 낮은 분리율을 나타내었다.

분리 균주에 대한 항생제 내성율이 높은 약제를 축종별로 살펴보면, 소유래 균주에서는 MC(71.4%), 돼지유래 균주에서는 TB(78.3%), PC(75.6%), TC, DA(64.8%), SXT, OX, ENR, CIP(62.1%), 닭유래 균주에서는 CIP(72.9%), TC(67.5%)이었다. 이 등(2010)의 돼지유래 균주에 대한 내성결과에서 PC(94.1%), TC(70.6%), EM와 DA(64.7%), GM(76.5%)로 본 실험과 비교 시 DA은 비슷하고 전반적으로 본 실험이 낮은 내성율을 나타내었다. 이 등(2010)의 소유래 균주에 대한 내성결과에서는 PC(88.9%), TC과 EM(66.7%), DA (55.67%), GM (77.8%)로 본 실험과 비교 시 본 실험 결과가 모두 더 낮은 내성율을 나타내었다. 이는 2010년보다 우리나라 축산 사육 시 사료첨가용 항생제 사용금지 등 항생제 남용이 현저히 줄어든 점과 축종별로 자주 사용되는 항생제의 종류가 시기에 따라 다름에 따라 항생제 내성율도 차이가 있을 것으로 사료된다. 2022년도 국가 항생제 사용 및 내성 모니터링 보고서(농림축산검역본부, 2023)에 따르면 2022년 축산용 항생제 판매량(추정치)이 축종별로는 돼지, 닭, 소 순으로 판매되었다. 항생제 계열로는 penicillins계 항생제가 가장 많이 판매되었고, tetracyclines계, phenicols계, macrolides 순이었다. 본 실험에서도 축종별로는 돼지에서 내성율이 가장 높았으며, 돼지에서 penicillin, tetracycline에서 높은 내성율을 보인 것을 보면 Normand 등(2000)의 항생제 내성 양상은 국가, 지역은 물론 임상에서 사용하는 항생제의 종류와 노출빈도, 분리균의 유래에 따라 달라질 수 있다는 보고와 일치하였다.

분리한 S. aureus 96.2% (78주)가 한 종류 이상의 약제에 내성 양상을 보였으며, 65.4% (53주)는 3가지 이상 항생제에 대해 내성을 보이는 다약제 내성균이었다. 축종별로는 소에서 28.5% (2주), 돼지에서 70% (26주), 닭에서 67.5% (25주)의 비율로 다약제 내성률을 나타내었다. Yang 등(2008)이 국내 유통 축산물에서 분리한 S. aureus의 3가지 이상 항생제에 내성을 보이는 다약제 내성균은 39.4%로 본 실험의 결과가 다소 높은 내성율을 보였다.

항생제의 내성 기전은 크게 나누면 항생제의 세균세포 내 침투 및 축적의 방해, 표적분자의 변형으로 인한 내성, 항생제의 불활성화를 통한 내성으로 인해 이루어진다. Staphylococcus의 내성기전은 대부분의 균주는 거의 90% 이상 β-lactamase를 생성하여 penicillin, ampicillin에 내성을 보인다. 이 경우 내성은 plasmid를 통해 전달되고 종종 erythromycin 및 다른 항균제 내성을 동반하기도 한다. 1950년대에 penicillin, tetracycline, erythromycin 등 항균제에 내성을 보이는 다제내성 staphylococcus의 대규모 병원감염이 있었고, 페니실린 분해효소에 안정한 methicillin이 개발되면서 다제내성 staphylococcus의 감소추이를 보였다. 그러나 1970년대 말경 MRSA가 출현하면서 전 세계적으로 병원감염의 주요한 원인균으로 자리잡게 되었다. MRSA의 내성기전은 세포벽 합성효소인 페니실린 결합단백(PBP)이 변화되어 β-lactam과의 친화성이 없어졌기 때문이다. 이 PBP는 PBP2’(PBP 2a)로 불리며 mecA 유전자에 의해서 조절된다. mecA 유전자는 MRSA의 염색체에는 있으나 methicillin sensitive Staphylococcus aureus (MSSA)에는 없어 MSSA가 이 유전자를 획득하여 methicillin resistant Staphylococcus aureus (MRSA)가 되었다고 할 수 있다. MRSA는 methicillin에 대해서 뿐 아니라 모든 β-lactam제에 내성을 나타낸다(이연희, 1998; 송재훈, 1998). 따라서 동물유래 MRSA가 국내에서 분리되고 증가된다면 동물의 치료에 심각한 문제를 야기할 뿐 아니라 인류의 건강을 위협할 수 있으므로, 지속적인 모니터링이 이루어져야 할 것이다.

본 연구에서 분리된 S. aureus 81주 중 oxacillin에 내성을 보인 MRSA는 소에서 2주, 돼지에서 23주, 닭에서 0주 분리되어 총 25주(30.8%)였다. Methicillin에 내성, 중간내성, 감수성을 보인 균주로 분류하여 mecA 유전자의 보유현황을 조사한 결과는 methicillin에 내성을 보인 25주 중 mecA유전자는 돼지에서 분리된 7주(28%)에서만 확인되었다. Methicillin에 중간내성이거나 감수성인 균주에서는 mecA 유전자는 확인되지 않았다. 이처럼 oxacillin 양성이면서 mecA 음성인 균주는 mecA유전자의 변이나 균주의 저장 과정에서 소실 또는 β-lactam의 과잉 생산 등에 의한 다른 methicillin 내성의 기전을 고려해 볼 수 있다(Chambers, 1997). 2021년 농림축산검역본부에서 전국 축산항생제 내성균 사업실적(농림축산검역본부, 2022a)과 비교 시 전국적으로 MRSA는 소에서 8.8%, 돼지에서 9.8%, 닭에서 미검출로 보고되어 본 조사에서는 소에서 28.5%, 돼지에서 62.1%로 다소 높은 methicillin 내성율을 나타내었다.

MRS 균주의 대부분은 3가지 계열 이상의 항생제에 대해 적어도 한 종류 이상의 약제에 내성을 보인 다약제 내성균으로 알려져 있다(Chanayat 등, 2021). 조 등(2022)이 개의 외이도에서 분리한 MRS 균주도 77.5%가 다약제 내성균으로 확인되었으며, 본 실험에서 분리된 25균주의 MRSA도 3가지 계열 이상의 항생제에 대해 96%의 다약제 내성균으로 확인되었다. 특히 mecA 유전자가 검출된 균주는 FOX, PC, TC, DA, SXT, ENR, TB에 100% 내성을 보여 다제 내성양상을 나타냈다. 이는 MRS 균주는 penicillin 같은 β-lactam 계열의 항생제뿐만 아니라 tetracycline, erythromycin, ciprofloxacin 및 clindamycin 같은 non-β-lactam 계열의 항생제에 대해서도 높은 내성을 나타낸(Perreten 등, 2010; Chanayat 등, 2021) 기존의 결과와 유사하였다.

이상의 결과 대구지역 도축장 출하 가축의 도체에서 분리된 S. aureus에서 항생제 내성 양상과 MRSA 현황을 조사하였다. 식육은 MRSA의 오염원으로 가능성이 있어 공중보건 관점에서도 중요하게 생각된다. 따라서 항생제의 신중한 사용과 더불어 내성균 확산방지를 위하여 임상과 비임상을 총괄하는 항생제 사용 및 내성률 관리가 요구된다.

대구지역 도축장에서 출하된 식육 1,360건을 대상으로 S. aureus 81주를 분리하였고, 81주에 대해 항생제 내성 양상과 MRSA 현황을 조사하였다.

S. aureus는 소에서 1.4% (7주/480건), 돼지에서 7.7% (37주/480건), 닭에서 9.2% (37주/400건) 분리되었다. 소유래 S. aureus 7주는 MC 71.4%, QD 42.8%, TC, DA, PC, SXT, OX, ENR, TB, EM은 각 28.5%, CM, AN, GM, CIP는 각 14.2%의 내성율을 나타내었다. 돼지유래 S. aureus 37주는 TOB 78.3%, PC는 75.6%, TC, DA는 각 64.8%, SXT, OX, ENR, CIP는 각 62.1%, AN, GM은 각 59.4%, EM 51.3%, MC 48.6%, QD는 37.8%, CM 24.3%, FOX 21.6%의 내성율을 나타내었다. 닭유래 S. aureus 37주는 CIP 72.9%, TC 67.5%, GM 51.3%, TOB 43.2%, DA 8.1%, PC, ENR 5.4%, MC, AN 2.7%의 내성율을 나타내었다. 분리된 S. aureus 중 65.4% (53주)는 3가지 이상 계열의 항생제에 대해 내성을 보인 다약제내성균이었다.

MRSA는 총 81균주 중 소에서 2주, 돼지에서 23주 분리되어 총 25주(30.8%)였다. MRSA 25주 중 mecA 유전자는 돼지에서 분리된 7주(28%)만 검출되었다. mecA 유전자가 검출된 균주는 FOX, PC, TC, DA, SXT, ENR, TB에 100% 내성을 보였으며, 10가지 이상에 내성을 나타낸 다약제내성균이었다.

No potential conflict of interest relevant to this article was reported.

  1. 농림축산검역본부, 식품의약품안전처. 2023. 2022년도 국가 항생제 사용 및 내성 모니터링.
  2. 농림축산검역본부. 2022a. 2021년도 축산항생제 내성균 감시체계 구축 사업 추진실적.
  3. 농림축산검역본부. 2022b. 2022년 축산 항생제 내성균 감시체계 구축 교육자료.
  4. Carven N, Jones TO. 1986. Antimicrobial drug susceptibility of staphylococcus aureus isolated from bovine mastitis. Vet Rec 118:290-291.
    Pubmed CrossRef
  5. Chambers HF. 1997. Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications. Clin Microbiol Rev 10:781-791.
    Pubmed KoreaMed CrossRef
  6. Chanayat Y, Akatvipat A, Bender JB, Punyapornwithaya V, Meeyam T, Pichpol U. 2021. The SCC mec Types and Antimicrobial resistance among methicillin-resistant Staphylococcus species isolated from dogs with superficial pyoderma. Vet Sci 13:85.
    Pubmed KoreaMed CrossRef
  7. Cho JK, Lee JW, Kim JM. 2022. Antimicrobial resistance and virulence factors in staphylococci isolated from canine otitis exterma. Korean J Vet Serv 43:170-180.
    CrossRef
  8. Davis BD, Dulbecco R, Eisen HN, et al. 1990. Staphylcocci. Microbiology. 4ed. Lippncott : 539-550.
  9. Dziva F, Wint C, Auguste T, Heeraman C, Dacon C, Koma LM. 2015. First identification of methicillin-resistant Staphylococcus pseudintermedius strains amone coagulase-positive staphylococci isolated from dogs with otitis externa in Trinidad, West Indies. Infect Ecol Epidemiol 5:29170.
    Pubmed KoreaMed CrossRef
  10. Frost AJ and O'Boyle D. 1981. The Resistance to Antimicrobial Agent of Staphylcoccus aureus isolated from the bovine udder. Aust Vet J 57:262-267.
    Pubmed CrossRef
  11. Hwang IG, Yoon SH. 2010. Methicillin Staphylococcus aureus(MRSA) as foodborne biological hazard. Safe Food 5:26-35.
  12. Kim JS. 2020. Infectious Disease : Past, Present, and Future. Vacuum Magazine 6:13-17.
  13. Lee WW, Jung BY, Kim SH, Lee SM, Lee GR, Kim YH. 2010. Isolation of Staphylococcus aureus and detaction of enterotoxin from pigs and cattle carcass by PCR. Korean J Vet Serv 33:255-261.
  14. Lee YH. 1998. Several Issues on the antibiotics resistance. 24:3-9.
  15. McDermott PF, Zhao S, Wagner DD, Simjee S, White DG. 2022. The food safety perspective of antibiotic resistance. Animal Biotech 13:71-84.
    Pubmed CrossRef
  16. McEween S and Reid-Smith R. 2004. Antimicrobial resistance in food. Can. J. Infect. Dis. Med. Microbiol 15:201-203.
    Pubmed KoreaMed CrossRef
  17. Myllys V, Brofeld E, et al. 1998. Bovine Mastitis in Filand in 1988 and 1995 - Changes in prevalence and Antimicrobial Resistance. Acta Vet Scan 39:119-126.
    Pubmed KoreaMed CrossRef
  18. Nakaminami H, Okamura Y, Tanaka S, Wajima T, Noguchi N. 2020. Prevalence of antimicrobial- resistant staphylococci in nares and affected sites of pet dogs with superficial pyoderma. J Vet Med Sci 83:214-219.
    Pubmed KoreaMed CrossRef
  19. Normand EH, Gibson NR, Reid SWJ, Taylor DJ. 2000. Antimicrobial-resistance trends in bacterial isolates from companion-animal communitu practice in the UK. Prev Vet Med 46:267-278.
    Pubmed CrossRef
  20. Perreten V, Kadlec K, Schwarz S, Andersson UG, Finn M, Greko C, Moodley A, Kania SA, Frank LA, Bemis DA, Franco A, Iurescia M, Battisti A, Duim B, Wagenaar JA, van Duijkeren E, Weese JS, Fitzgerald JR, Guardabassi L. 2010. Clonal spread of methicillin-resistant Staphylococcus pseudintermedius in Europe and North America: an international multicentre study. J Antimicrob Chemother 65:1145-1154.
    Pubmed CrossRef
  21. Song JH. 1998. Mechanisms of antimicrobial resistance. The Microorganisms and Industry 24:20-25.
  22. Timoney JF, Gillespie JH, Scott FW, Barlough JF. 1988. The Genus Staphylococcus. In: Hagan and Bruner’ s Microbiology and infectious Disease of Domestic Animals. 8ed. Comstock Publishing Associates, A division of Cornell University Press, Ithaca and London: 171-180.
  23. Yang JI, Lee SM, Lee G, Lee HJ, Kim MK, Cha YJ. 2008. A Survey of Staphylococcus aureus contamination and antibiotic susceptibility in retail meat. J Korean Soc Food Sci Nutr 34:528-533.
    CrossRef

Article

Original Article

Korean J. Vet. Serv. 2024; 47(1): 27-33

Published online March 30, 2024 https://doi.org/10.7853/kjvs.2024.47.1.27

Copyright © The Korean Socitety of Veterinary Service.

대구지역 도축장 출하가축의 도체에서 분리한 Staphylococcus aureus의 항생제 내성과 MRSA 검출에 관한 연구

임현숙*ㆍ서동균ㆍ김환득ㆍ이혜화ㆍ김정미ㆍ임미하ㆍ조재근

대구광역시 보건환경연구원

Received: January 23, 2024; Revised: March 8, 2024; Accepted: March 9, 2024

Study on antimicrobial resistance and detection of MRSA of Staphylococcus aureus isolated from carcass in Daegu slaughterhouses

Hyun-Sook Lim *, Dong-Keun Suh , Hwan-Deuk Kim , Hye-Hwa Lee , Jeong-Mi Kim , MiHa Im , Jae-Keun Cho

Metropolitan Health & Environmental Research Institute, Daegu 42183, Korea

Correspondence to:Hyun-Sook Lim
E-mail: hyunsooki@korea.kr
https://orcid.org/0000-0002-1701-3241

Received: January 23, 2024; Revised: March 8, 2024; Accepted: March 9, 2024

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

At the present study, it was aimed to explore the states of antimicrobial resistant Staphylococcus aureus isolates from 1,360 chickens, pigs and cattle carcass (400 chickens, 480 pigs and 480 cattle) in Daegu province from January 2022 to December 2022. Among 1,360 samples, 81 of S. aureus were isolated cattle (1.4%), pigs (7.7%) and chickens (9.2%). In antimicrobial susceptibility test, all of the isolates were demonstrated susceptibility to rifampin. But the isolates were showed resistance other antibiotics in order of tetracycline (62.9%), ciprofloxacin (62.9%), tobramycin (58.0%), gentamicin (51.8%), amikacin (40.7%), penicillin (39.5%), clindamycin (35.8%), enrofloxacin (33.3%), trimethoprim/sulfamethoxazole (30.8%), oxacillin (30.8%), minocycline (29.6%), erythromycin (25.9%), quinupristin/dalfopristin (20.9%), chloramphenicol (12.3%), cefoxitin (9.8%). Among the 81 S. aureus isolates, 25 (30.8%) methicillin-resistant staphylococcus aureus (MRSA) were observed. Seven (28.0%) of 25 MRSA harbored mecA gene. About 96% of MRSA were multidrug resistance to at least 3 more drugs. A continuous monitoring and surveillance program to prevent antimicrobial resistance in livestock products is demanded.

Keywords: Staphylococcus aureus, MRSA, Antibiotics susceptibility

서 론

항생제 내성은 신종 코로나바이러스감염증(코로나19) 팬데믹 이후 인류에게 발생하는 가장 큰 위기로 꼽히고 있다. 세계적으로 항생제 내성균으로 사망하는 사람이 현재는 연간 약 70 만명으로 추정되고 있으며, 내성 문제를 이대로 방치하면 2050년에는 약 1000 만명으로 증가할 것으로 추정한다(Kim, 2020).

축산분야의 항생제 내성은 직·간접적으로 사람에게 전파될 가능성이 있으며, 산업동물에서의 항생제 사용으로 유발되는 사람에서 위해는 다음과 같이 두 가지 방법에 따라 발생할 수 있다(McEween과 Reid-Smith, 2004; McDermott 등, 2022).

첫째 축산식품에 항생제가 잔류하여 잔류항생제의 섭취로 사람에게 독성이 발생하거나 사람의 공생균에 내성이 유도될 수 있다. 두 번째로는 산업동물에 사용되는 항생제로 인해 산업동물에서 항생제 내성균이 발생하고, 축산식품의 섭취를 통해 항생제 내성균 또는 내성인자가 사람에 전파되는 것이다.

이러한 이유로 전 세계적으로 항생제 내성균 모니터링 시스템의 필요성이 대두되어 국내 축산분야에서는 2003년부터 농림축산검역본부에서 단독으로 추진해오다가 전국적인 수준의 국가 차원 시스템 구축의 필요성을 인식하고 2008년부터는 전국 동물위생시험소 및 보건환경연구원에서 참여하는 축산 항생제 내성균 감시체계 구축 사업으로 확대되었다. 본 사업에서는 생산단계 가축 및 도체와 반려동물을 대상으로 지표세균, 식중독 세균, 동물 병원성 세균에 대한 항생제 내성을 조사하고 있다(농림축산검역본부, 2022b). 생산단계 가축의 도체와 분변에서 지표세균인 E. coli, E. faecium, E. faecalis, 식중독 세균인 Salmonella spp. C. jejuni/coli, S. aureus를 모니터링하고 있다. 그 중 S. aureus는 그람 양성 구균으로 자연계에 널리 분포하고 있으며, 사람과 동물의 피부에 상재하는 정상 세균이지만, 적당한 환경조건이 주어지면 여러 가지 질병을 일으키는 기회 감염균이다. 황색 색소를 생산하고 혈액배지에서 용혈성을 나타내며, 병원성이 강하고, 조직 침습성이 높아 사람과 동물에 농가진, 농양, 봉와직염 등의 피부감염증, 창상감염, 골수염, 경부림프선염, 식중독, 폐렴, 패혈증 및 뇌수막염 등의 감염증을 일으키는 것으로 알려져 있다(Timoney 등, 1988; Davis 등, 1990). S. aureus로 인한 여러 가지 질병을 치료하기 위해 광범위 항생제의 무분별한 사용으로 내성균이 출현하였고, 특히 다제내성균이 급격히 증가하여 사람과 동물의 치료에 많은 어려움이 있는 실정이다(Frost와 O’Boyle, 1981; Carven, 1986; Myllys 등, 1998).

S. aureus는 다른 균에 비해 내성 획득 속도가 빠르고, 주로 β-lactamase를 생성하여 β-lactam계열의 항생제에 내성을 가지며, plasmid를 통해 전달되어 다른 항균제 내성과 동반하기도 한다. β-lactamase에 의해 가수분해를 받지 않는 반합성 페니실린계인 methicillin이 S. aureus의 감염 치료에 이용되고부터 methicillin에 고도 내성인 methicillin-resistant staphylococcus aureus (MRSA)가 출현하여 병원 내 감염의 주요한 원인균으로 알려져 왔다(이연희, 1998; 송재훈, 1998).

따라서 본 연구의 목적은 대구지역 도축장 출하 가축의 도체에서 S. aureus를 분리하여 항생제 내성 양상과 MRSA의 존재 여부를 파악하여 S. aureus의 내성 확산 방지와 사람과 동물 간의 상호감염에 대한 기초자료를 확보하고자 한다.

재료 및 방법

균분리 및 동정

2022년 1월부터 2022년 12월까지 대구지역 도축장 및 도계장에서 출하하는 소 480두, 돼지 480두, 닭 400수를 대상으로 식육 도체 표면에서 시료를 채취하였다. 소 및 돼지 도체는 표면(10×10 cm)의 3개 부위에서 채취하고, 닭의 도체는 1마리 전체를 대상으로 채취하여 검사하였다. 증균배양은 도체 현탁액 Buffered Peptone Water (BPW) 1 mL를 6.5% NaCl을 첨가한 tryptic soy broth에서 37℃, 16시간 배양하였다. 배양액 50 µL를 CHROMagar-Staph. aureus에 접종 후, 37℃, 16시간 배양하였다. 전형적인 집락을 선택해서 blood agar에 접종 후 37℃, 16시간 배양하였고, β-hemolysis 현상이 일어나는 균을 nutrient agar에 접종하여 37℃, 16시간 배양함과 동시에 coagulase test를 실시하여 양성임을 확인하였다.

Genomic DNA 추출

공시균에 대한 genomic DNA 추출은 boiling 법으로 실시하였다. 우선 tryptic soy broth (Oxoid, UK)에 접종하여 37℃에서 18∼24시간 진탕 배양하여 얻은 균 부유액 1 mL를 13,000 rpm에서 2분간 원심분리한 후 상층액을 제거한 다음 멸균 증류수 0.5 mL로 재부유 하였다. 부유액은 끓는 물에 10분간 가열한 다음 13,000 rpm에서 10분간 원심분리한 후 상층액을 취하여 template DNA로 사용하였다.

PCR에 의한 S. aureus 확인시험

S. aureus의 최종 확인은 Real-time PCR (7500 fast real time systems, Applied biosystems)을 이용하였다. PowerCheck staphylococcus aureus Real-time PCR kit (코젠바이오텍)를 사용하였으며, 추출한 template DNA 5 µL를 staphylococcus aureus Real-time PCR premix에 첨가해 총 20 µL 되게 하여 7500 fast real time systems으로 실험을 수행하였다.

항생제 감수성 시험

항균제 감수성 시험은 Clinical and Laboratory Standards Institute의 기준(2017)에 따라 디스크 확산법으로 실시하였다. 항생제 디스크는 Oxoid사(UK)의 oxacillin (1 µg, OX), cefoxitin (30 µg, FOX), penicillin (10 UI, PC), gentamicin (10 µg, GM), amikacin (30 µg, AN), tobramycin (10 µg, TB), erythromycin (15 µg, EM), tetracycline (30 µg, TC), minocycline (30 µg, MC), ciprofloxacin (5 µg, CIP), enrofloxacin (10 µg, ENR), clindamycin (2 µg, DA), trimethoprim/sulfamethoxazole (1.25/23.75 µg, SXT), chloramphenicol (30 µg, CM), rifampin (5 µg, RD), quinupristin/dalfopristin (15 µg, QD) 등 16종을 공시하였다. S. aureus는 OX에 내성인 균주를 MRSA로 판정하였다.

약제내성 유전자(mecA) 검출

약제내성 유전자(mecA)의 검출은 PCR을 이용하여 이전 연구자들의 방법에 따라 실시하였다(Nakaminami 등, 2020). PCR 반응은 Maxime PCR PreMix (i-StarTag, Intron, Korea)에 각각의 10 pmol primer 1 µL와 template DNA 1 µL를 넣은 후, 멸균된 증류수를 첨가하여 최종 반응량이 20 µL 되게 하여 Tprofessional Thermal Cycler (Biometra, Germany)로 실험을 수행하였다(Table 1). PCR 반응 조건은 predenaturation을 95℃ 5분간 실시 후, denaturation은 94℃에서 30초, annealing은 58℃에서 45초, polymerization은 72℃에서 1분 30초간 총 25 cycle로 증폭하고, 그 후 72℃에서 5분간 post-polymerization을 실시하였다. 증폭된 산물은 자동 전기 영동장치(QIAxcel Advanced System)를 이용하여 확인하였다.

Table 1 . Synthetic oligonucleotides used as primers for PCR.

Target geneSequence (5’-3’)Size (bp)Reference
mecATGGCTATCGTGTCACAATCG310Dziva et al, 2015
CTGGAACTTGTTGAGCAGAG

결 과

S. aureus의 분리율

소와 돼지, 닭의 도체에서 분리한 S. aureus의 분리율은 Table 2에서와 같이 총 1,360건 중 5.9% (81주)였다. 축종별 분리율은 소에서 1.4% (7주/480건), 돼지에서 7.7% (37주/480건), 닭에서 9.2% (37주/400건)였다.

Table 2 . Isolation rates of S. aureus isolates from cattle, pigs and chickens carcass.

AnimalNo. of samples
TestedIsolated (%)
Cattle4807 (1.4)
Pig48037 (7.7)
Chicken40037 (9.2)
Total1,36081 (5.9)


항생제 감수성시험

분리된 S. aureus 81주에 대한 항생제 감수성 시험검사 결과는 Table 3과 같다. 소유래 S. aureus 7주는 FOX, RD은 100% 감수성을 나타내었고, 내성율은 MC 5주(71.4%), QD 3주(42.8%), TC, DA, PC, SXT, OX, ENR, TB, EM은 각 2주(28.5%), CM, AN, GM, CIP은 각 1주(14.2%) 순이었다.

Table 3 . Antimicrobial resistance of 81 S. aureus isolates from cattle, pigs and chickens carcass.

Antimicrobial agentNo. of isolates with indicated antimicrobial resistance (%)
Cattle (n=7)Pigs (n=37)Chickens (n=37)Total (n=81)
Cefoxitin08 (21.6%)08 (9.8%)
Tetracycline2 (28.5%)24 (64.8%)25 (67.5%)51 (62.9%)
Clindamycin2 (28.5%)24 (64.8%)3 (8.1%)29 (35.8%)
Penicillin2 (28.5%)28 (75.6%)2 (5.4%)32 (39.5%)
Trimethoprim/sulfamethoxazole2 (28.5%)23 (62.1%)025 (30.8%)
Oxacillin2 (28.5%)23 (62.1%)025 (30.8%)
Quinupristin/dalfopristin3 (42.8%)14 (37.8%)017 (20.9%)
Erythromycin2 (28.5%)19 (51.3%)021 (25.9%)
Chloramphenicol1 (14.2%)9 (24.3%)010 (12.3%)
Minocycline5 (71.4%)18 (48.6%)1 (2.7%)24 (29.6%)
Enrofloxacin2 (28.5%)23 (62.1%)2 (5.4%)27 (33.3%)
Rifampin0000
Amikacin1 (14.2%)22 (59.4%)1 (2.7%)33 (40.7%)
Tobramycin2 (28.5%)29 (78.3%)16 (43.2%)47 (58.0%)
Gentamicin1 (14.2%)22 (59.4%)19 (51.3%)42 (51.8%)
Ciprofloxacin1 (14.2%)23 (62.1%)27 (72.9%)51 (62.9%)


돼지유래 S. aureus 37주는 RD에 대해 100%의 감수성을 나타내었고, 내성율은 TB 29주(78.3%), PC 28주(75.6%), TC과 DA은 각 24주(64.8%), SXT과 OX, ENR, CIP은 각 23주(62.1%), AN, GM은 각 22주(59.4%), EM 19주(51.3%), MC 18주(48.6%), QD 14주(37.8%), CM 9주(24.3%), FOX 8주(21.6%) 순이었다.

닭유래 S. aureus 37주는 FOX, SXT, OX, QD, EM, CM, RD에 대해 100%의 감수성을 나타내었고, 내성율은 CIP 27주(72.9%), TC 25주(67.5%), GM 19주(51.3%), TB 16주(43.2%), DA 3주(8.1%), PC과 ENR은 각 2주(5.4%), MC과 AN은 각 1주(2.7%) 순이었다.

분리한 S. aureus 96.2% (78주)는 사용된 한 종류 이상의 약제에 내성을 나타내었으며, 65.4% (53주)는 3가지 이상 계열의 항생제에 대해 내성을 보인 다약제 내성균이었다(Table 4). 축종별로 보면 소에서 28.5% (2주), 돼지에서 70% (26주), 닭에서 67.5% (25주)의 비율로 다약제 내성률을 나타내었다.

Table 4 . Distribution of multi-drug resistance in 81 S. aureus isolated from cattle, pigs and chickens carcass.

No. of antimicrobial classesNo. of resistant isolates (%)
Cattle (n=7)Pigs (n=37)Chickens (n=37)Total (n=81)
311011 (13.5)
421012 (14.8)
555 (6.1)
811 (1.2)
10167 (8.6)
1122 (2.4)
1288 (9.8)
13134 (4.9)
1422 (2.4)
1511 (1.2)
Total2 (28.5)26 (70)25 (67.5)53 (65.4)


MRSA 분리 및 mecA 유전자 검출

본 연구에서 분리된 S. aureus 81주 중 OX에 내성을 보인 MRSA는 소에서 2주, 돼지에서 23주, 닭에서 0주 분리되어 총 25주(30.8%)였다. Methicillin에 내성, 중간내성, 감수성을 보인 균주로 분류하여 mecA 유전자의 보유현황을 조사한 결과는 Table 5와 같다. Methicillin에 내성을 보인 25주 중 mecA 유전자는 돼지에서 분리된 7주(28%)에서만 검출되었다. Methicillin에 중간내성이거나 감수성인 균주에서는 mecA 유전자는 검출되지 않았다.

Table 5 . Distribution of mecA gene in 81 S. aureus isolated from cattle, pigs and chickens.

AnimalNo. of isolatesMethicillin-resistant S. aureusMethicillin-intermediate resistant S. aureusMethicillin-susceptible S. aureus
No. of isolatesmecA (+)No. of isolatesmecA (+)No. of isolatesmecA (+)
Cattle7204010
Pig37237 (30.4%)9050
Chicken370050320
Total81257 (28%)180380


본 실험에서 분리된 25균주의 MRSA도 3가지 계열 이상의 항생제에 대해 24균주(96%)가 다약제 내성균으로 확인되었다(Table 6). Methicillin에 감수성이 있는 균주는 23균주(60.5%), 중간내성인 균주는 6균주(33.3%)가 3가지 계열 이상의 다약제 내성균으로 확인되었다. 특히 mecA 유전자가 검출된 균주는 FOX, PC, TC, DA, SXT, ENR, TB, OX에 100% 내성을 보여 다제 내성양상을 보이고, 7균주 모두 10가지 이상의 항생제에 내성을 나타내었다.

Table 6 . Distribution of multi-drug resistance pattern among 81 S. aureus.

No. of antimicrobial classesNo. of resistant isolates (%)
Methicillin-resistant S. aureus (n=25)Methicillin-intermediate resistant S. aureus (n=18)Methicillin-susceptible S. aureus (n=38)
32
439
59
65
7
81
9
1061
112
128
134
142
151
Total24 (96.0)6 (33.3)23 (60.5)

고 찰

본 실험은 2022년 1월부터 12월까지 대구지역 도축장 및 도계장에 출하하는 소, 돼지, 닭의 도체 1,360건을 대상으로 S. aureus 분리율을 조사하였고, S. aureus에 대한 항생제 내성검사를 실시하였다. S. aureus의 분리율은 5.9% (81주/1,360건)이었다. 축종별로 보면 소에서 1.4% (7주/480건), 돼지에서 7.7% (37주/480건), 닭에서 9.2% (37주/400건)이었다. 이 등(2010)이 보고한 소와 돼지 도체표면에서 S. aureus 분리율은 소에서 5.6%, 돼지에서 10.6%였으며, 황 등(2010)이 2003∼2008년 국내 도축장의 동물 도체에서 S. aureus 분리율을 조사한 결과 소에서 9.8%, 돼지에서 18.8%, 닭에서 36.6%로 본 실험이 더 낮은 분리율을 나타내었다.

분리 균주에 대한 항생제 내성율이 높은 약제를 축종별로 살펴보면, 소유래 균주에서는 MC(71.4%), 돼지유래 균주에서는 TB(78.3%), PC(75.6%), TC, DA(64.8%), SXT, OX, ENR, CIP(62.1%), 닭유래 균주에서는 CIP(72.9%), TC(67.5%)이었다. 이 등(2010)의 돼지유래 균주에 대한 내성결과에서 PC(94.1%), TC(70.6%), EM와 DA(64.7%), GM(76.5%)로 본 실험과 비교 시 DA은 비슷하고 전반적으로 본 실험이 낮은 내성율을 나타내었다. 이 등(2010)의 소유래 균주에 대한 내성결과에서는 PC(88.9%), TC과 EM(66.7%), DA (55.67%), GM (77.8%)로 본 실험과 비교 시 본 실험 결과가 모두 더 낮은 내성율을 나타내었다. 이는 2010년보다 우리나라 축산 사육 시 사료첨가용 항생제 사용금지 등 항생제 남용이 현저히 줄어든 점과 축종별로 자주 사용되는 항생제의 종류가 시기에 따라 다름에 따라 항생제 내성율도 차이가 있을 것으로 사료된다. 2022년도 국가 항생제 사용 및 내성 모니터링 보고서(농림축산검역본부, 2023)에 따르면 2022년 축산용 항생제 판매량(추정치)이 축종별로는 돼지, 닭, 소 순으로 판매되었다. 항생제 계열로는 penicillins계 항생제가 가장 많이 판매되었고, tetracyclines계, phenicols계, macrolides 순이었다. 본 실험에서도 축종별로는 돼지에서 내성율이 가장 높았으며, 돼지에서 penicillin, tetracycline에서 높은 내성율을 보인 것을 보면 Normand 등(2000)의 항생제 내성 양상은 국가, 지역은 물론 임상에서 사용하는 항생제의 종류와 노출빈도, 분리균의 유래에 따라 달라질 수 있다는 보고와 일치하였다.

분리한 S. aureus 96.2% (78주)가 한 종류 이상의 약제에 내성 양상을 보였으며, 65.4% (53주)는 3가지 이상 항생제에 대해 내성을 보이는 다약제 내성균이었다. 축종별로는 소에서 28.5% (2주), 돼지에서 70% (26주), 닭에서 67.5% (25주)의 비율로 다약제 내성률을 나타내었다. Yang 등(2008)이 국내 유통 축산물에서 분리한 S. aureus의 3가지 이상 항생제에 내성을 보이는 다약제 내성균은 39.4%로 본 실험의 결과가 다소 높은 내성율을 보였다.

항생제의 내성 기전은 크게 나누면 항생제의 세균세포 내 침투 및 축적의 방해, 표적분자의 변형으로 인한 내성, 항생제의 불활성화를 통한 내성으로 인해 이루어진다. Staphylococcus의 내성기전은 대부분의 균주는 거의 90% 이상 β-lactamase를 생성하여 penicillin, ampicillin에 내성을 보인다. 이 경우 내성은 plasmid를 통해 전달되고 종종 erythromycin 및 다른 항균제 내성을 동반하기도 한다. 1950년대에 penicillin, tetracycline, erythromycin 등 항균제에 내성을 보이는 다제내성 staphylococcus의 대규모 병원감염이 있었고, 페니실린 분해효소에 안정한 methicillin이 개발되면서 다제내성 staphylococcus의 감소추이를 보였다. 그러나 1970년대 말경 MRSA가 출현하면서 전 세계적으로 병원감염의 주요한 원인균으로 자리잡게 되었다. MRSA의 내성기전은 세포벽 합성효소인 페니실린 결합단백(PBP)이 변화되어 β-lactam과의 친화성이 없어졌기 때문이다. 이 PBP는 PBP2’(PBP 2a)로 불리며 mecA 유전자에 의해서 조절된다. mecA 유전자는 MRSA의 염색체에는 있으나 methicillin sensitive Staphylococcus aureus (MSSA)에는 없어 MSSA가 이 유전자를 획득하여 methicillin resistant Staphylococcus aureus (MRSA)가 되었다고 할 수 있다. MRSA는 methicillin에 대해서 뿐 아니라 모든 β-lactam제에 내성을 나타낸다(이연희, 1998; 송재훈, 1998). 따라서 동물유래 MRSA가 국내에서 분리되고 증가된다면 동물의 치료에 심각한 문제를 야기할 뿐 아니라 인류의 건강을 위협할 수 있으므로, 지속적인 모니터링이 이루어져야 할 것이다.

본 연구에서 분리된 S. aureus 81주 중 oxacillin에 내성을 보인 MRSA는 소에서 2주, 돼지에서 23주, 닭에서 0주 분리되어 총 25주(30.8%)였다. Methicillin에 내성, 중간내성, 감수성을 보인 균주로 분류하여 mecA 유전자의 보유현황을 조사한 결과는 methicillin에 내성을 보인 25주 중 mecA유전자는 돼지에서 분리된 7주(28%)에서만 확인되었다. Methicillin에 중간내성이거나 감수성인 균주에서는 mecA 유전자는 확인되지 않았다. 이처럼 oxacillin 양성이면서 mecA 음성인 균주는 mecA유전자의 변이나 균주의 저장 과정에서 소실 또는 β-lactam의 과잉 생산 등에 의한 다른 methicillin 내성의 기전을 고려해 볼 수 있다(Chambers, 1997). 2021년 농림축산검역본부에서 전국 축산항생제 내성균 사업실적(농림축산검역본부, 2022a)과 비교 시 전국적으로 MRSA는 소에서 8.8%, 돼지에서 9.8%, 닭에서 미검출로 보고되어 본 조사에서는 소에서 28.5%, 돼지에서 62.1%로 다소 높은 methicillin 내성율을 나타내었다.

MRS 균주의 대부분은 3가지 계열 이상의 항생제에 대해 적어도 한 종류 이상의 약제에 내성을 보인 다약제 내성균으로 알려져 있다(Chanayat 등, 2021). 조 등(2022)이 개의 외이도에서 분리한 MRS 균주도 77.5%가 다약제 내성균으로 확인되었으며, 본 실험에서 분리된 25균주의 MRSA도 3가지 계열 이상의 항생제에 대해 96%의 다약제 내성균으로 확인되었다. 특히 mecA 유전자가 검출된 균주는 FOX, PC, TC, DA, SXT, ENR, TB에 100% 내성을 보여 다제 내성양상을 나타냈다. 이는 MRS 균주는 penicillin 같은 β-lactam 계열의 항생제뿐만 아니라 tetracycline, erythromycin, ciprofloxacin 및 clindamycin 같은 non-β-lactam 계열의 항생제에 대해서도 높은 내성을 나타낸(Perreten 등, 2010; Chanayat 등, 2021) 기존의 결과와 유사하였다.

이상의 결과 대구지역 도축장 출하 가축의 도체에서 분리된 S. aureus에서 항생제 내성 양상과 MRSA 현황을 조사하였다. 식육은 MRSA의 오염원으로 가능성이 있어 공중보건 관점에서도 중요하게 생각된다. 따라서 항생제의 신중한 사용과 더불어 내성균 확산방지를 위하여 임상과 비임상을 총괄하는 항생제 사용 및 내성률 관리가 요구된다.

결 론

대구지역 도축장에서 출하된 식육 1,360건을 대상으로 S. aureus 81주를 분리하였고, 81주에 대해 항생제 내성 양상과 MRSA 현황을 조사하였다.

S. aureus는 소에서 1.4% (7주/480건), 돼지에서 7.7% (37주/480건), 닭에서 9.2% (37주/400건) 분리되었다. 소유래 S. aureus 7주는 MC 71.4%, QD 42.8%, TC, DA, PC, SXT, OX, ENR, TB, EM은 각 28.5%, CM, AN, GM, CIP는 각 14.2%의 내성율을 나타내었다. 돼지유래 S. aureus 37주는 TOB 78.3%, PC는 75.6%, TC, DA는 각 64.8%, SXT, OX, ENR, CIP는 각 62.1%, AN, GM은 각 59.4%, EM 51.3%, MC 48.6%, QD는 37.8%, CM 24.3%, FOX 21.6%의 내성율을 나타내었다. 닭유래 S. aureus 37주는 CIP 72.9%, TC 67.5%, GM 51.3%, TOB 43.2%, DA 8.1%, PC, ENR 5.4%, MC, AN 2.7%의 내성율을 나타내었다. 분리된 S. aureus 중 65.4% (53주)는 3가지 이상 계열의 항생제에 대해 내성을 보인 다약제내성균이었다.

MRSA는 총 81균주 중 소에서 2주, 돼지에서 23주 분리되어 총 25주(30.8%)였다. MRSA 25주 중 mecA 유전자는 돼지에서 분리된 7주(28%)만 검출되었다. mecA 유전자가 검출된 균주는 FOX, PC, TC, DA, SXT, ENR, TB에 100% 내성을 보였으며, 10가지 이상에 내성을 나타낸 다약제내성균이었다.

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

Table 1 . Synthetic oligonucleotides used as primers for PCR.

Target geneSequence (5’-3’)Size (bp)Reference
mecATGGCTATCGTGTCACAATCG310Dziva et al, 2015
CTGGAACTTGTTGAGCAGAG

Table 2 . Isolation rates of S. aureus isolates from cattle, pigs and chickens carcass.

AnimalNo. of samples
TestedIsolated (%)
Cattle4807 (1.4)
Pig48037 (7.7)
Chicken40037 (9.2)
Total1,36081 (5.9)

Table 3 . Antimicrobial resistance of 81 S. aureus isolates from cattle, pigs and chickens carcass.

Antimicrobial agentNo. of isolates with indicated antimicrobial resistance (%)
Cattle (n=7)Pigs (n=37)Chickens (n=37)Total (n=81)
Cefoxitin08 (21.6%)08 (9.8%)
Tetracycline2 (28.5%)24 (64.8%)25 (67.5%)51 (62.9%)
Clindamycin2 (28.5%)24 (64.8%)3 (8.1%)29 (35.8%)
Penicillin2 (28.5%)28 (75.6%)2 (5.4%)32 (39.5%)
Trimethoprim/sulfamethoxazole2 (28.5%)23 (62.1%)025 (30.8%)
Oxacillin2 (28.5%)23 (62.1%)025 (30.8%)
Quinupristin/dalfopristin3 (42.8%)14 (37.8%)017 (20.9%)
Erythromycin2 (28.5%)19 (51.3%)021 (25.9%)
Chloramphenicol1 (14.2%)9 (24.3%)010 (12.3%)
Minocycline5 (71.4%)18 (48.6%)1 (2.7%)24 (29.6%)
Enrofloxacin2 (28.5%)23 (62.1%)2 (5.4%)27 (33.3%)
Rifampin0000
Amikacin1 (14.2%)22 (59.4%)1 (2.7%)33 (40.7%)
Tobramycin2 (28.5%)29 (78.3%)16 (43.2%)47 (58.0%)
Gentamicin1 (14.2%)22 (59.4%)19 (51.3%)42 (51.8%)
Ciprofloxacin1 (14.2%)23 (62.1%)27 (72.9%)51 (62.9%)

Table 4 . Distribution of multi-drug resistance in 81 S. aureus isolated from cattle, pigs and chickens carcass.

No. of antimicrobial classesNo. of resistant isolates (%)
Cattle (n=7)Pigs (n=37)Chickens (n=37)Total (n=81)
311011 (13.5)
421012 (14.8)
555 (6.1)
811 (1.2)
10167 (8.6)
1122 (2.4)
1288 (9.8)
13134 (4.9)
1422 (2.4)
1511 (1.2)
Total2 (28.5)26 (70)25 (67.5)53 (65.4)

Table 5 . Distribution of mecA gene in 81 S. aureus isolated from cattle, pigs and chickens.

AnimalNo. of isolatesMethicillin-resistant S. aureusMethicillin-intermediate resistant S. aureusMethicillin-susceptible S. aureus
No. of isolatesmecA (+)No. of isolatesmecA (+)No. of isolatesmecA (+)
Cattle7204010
Pig37237 (30.4%)9050
Chicken370050320
Total81257 (28%)180380

Table 6 . Distribution of multi-drug resistance pattern among 81 S. aureus.

No. of antimicrobial classesNo. of resistant isolates (%)
Methicillin-resistant S. aureus (n=25)Methicillin-intermediate resistant S. aureus (n=18)Methicillin-susceptible S. aureus (n=38)
32
439
59
65
7
81
9
1061
112
128
134
142
151
Total24 (96.0)6 (33.3)23 (60.5)

References

  1. 농림축산검역본부, 식품의약품안전처. 2023. 2022년도 국가 항생제 사용 및 내성 모니터링.
  2. 농림축산검역본부. 2022a. 2021년도 축산항생제 내성균 감시체계 구축 사업 추진실적.
  3. 농림축산검역본부. 2022b. 2022년 축산 항생제 내성균 감시체계 구축 교육자료.
  4. Carven N, Jones TO. 1986. Antimicrobial drug susceptibility of staphylococcus aureus isolated from bovine mastitis. Vet Rec 118:290-291.
    Pubmed CrossRef
  5. Chambers HF. 1997. Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications. Clin Microbiol Rev 10:781-791.
    Pubmed KoreaMed CrossRef
  6. Chanayat Y, Akatvipat A, Bender JB, Punyapornwithaya V, Meeyam T, Pichpol U. 2021. The SCC mec Types and Antimicrobial resistance among methicillin-resistant Staphylococcus species isolated from dogs with superficial pyoderma. Vet Sci 13:85.
    Pubmed KoreaMed CrossRef
  7. Cho JK, Lee JW, Kim JM. 2022. Antimicrobial resistance and virulence factors in staphylococci isolated from canine otitis exterma. Korean J Vet Serv 43:170-180.
    CrossRef
  8. Davis BD, Dulbecco R, Eisen HN, et al. 1990. Staphylcocci. Microbiology. 4ed. Lippncott : 539-550.
  9. Dziva F, Wint C, Auguste T, Heeraman C, Dacon C, Koma LM. 2015. First identification of methicillin-resistant Staphylococcus pseudintermedius strains amone coagulase-positive staphylococci isolated from dogs with otitis externa in Trinidad, West Indies. Infect Ecol Epidemiol 5:29170.
    Pubmed KoreaMed CrossRef
  10. Frost AJ and O'Boyle D. 1981. The Resistance to Antimicrobial Agent of Staphylcoccus aureus isolated from the bovine udder. Aust Vet J 57:262-267.
    Pubmed CrossRef
  11. Hwang IG, Yoon SH. 2010. Methicillin Staphylococcus aureus(MRSA) as foodborne biological hazard. Safe Food 5:26-35.
  12. Kim JS. 2020. Infectious Disease : Past, Present, and Future. Vacuum Magazine 6:13-17.
  13. Lee WW, Jung BY, Kim SH, Lee SM, Lee GR, Kim YH. 2010. Isolation of Staphylococcus aureus and detaction of enterotoxin from pigs and cattle carcass by PCR. Korean J Vet Serv 33:255-261.
  14. Lee YH. 1998. Several Issues on the antibiotics resistance. 24:3-9.
  15. McDermott PF, Zhao S, Wagner DD, Simjee S, White DG. 2022. The food safety perspective of antibiotic resistance. Animal Biotech 13:71-84.
    Pubmed CrossRef
  16. McEween S and Reid-Smith R. 2004. Antimicrobial resistance in food. Can. J. Infect. Dis. Med. Microbiol 15:201-203.
    Pubmed KoreaMed CrossRef
  17. Myllys V, Brofeld E, et al. 1998. Bovine Mastitis in Filand in 1988 and 1995 - Changes in prevalence and Antimicrobial Resistance. Acta Vet Scan 39:119-126.
    Pubmed KoreaMed CrossRef
  18. Nakaminami H, Okamura Y, Tanaka S, Wajima T, Noguchi N. 2020. Prevalence of antimicrobial- resistant staphylococci in nares and affected sites of pet dogs with superficial pyoderma. J Vet Med Sci 83:214-219.
    Pubmed KoreaMed CrossRef
  19. Normand EH, Gibson NR, Reid SWJ, Taylor DJ. 2000. Antimicrobial-resistance trends in bacterial isolates from companion-animal communitu practice in the UK. Prev Vet Med 46:267-278.
    Pubmed CrossRef
  20. Perreten V, Kadlec K, Schwarz S, Andersson UG, Finn M, Greko C, Moodley A, Kania SA, Frank LA, Bemis DA, Franco A, Iurescia M, Battisti A, Duim B, Wagenaar JA, van Duijkeren E, Weese JS, Fitzgerald JR, Guardabassi L. 2010. Clonal spread of methicillin-resistant Staphylococcus pseudintermedius in Europe and North America: an international multicentre study. J Antimicrob Chemother 65:1145-1154.
    Pubmed CrossRef
  21. Song JH. 1998. Mechanisms of antimicrobial resistance. The Microorganisms and Industry 24:20-25.
  22. Timoney JF, Gillespie JH, Scott FW, Barlough JF. 1988. The Genus Staphylococcus. In: Hagan and Bruner’ s Microbiology and infectious Disease of Domestic Animals. 8ed. Comstock Publishing Associates, A division of Cornell University Press, Ithaca and London: 171-180.
  23. Yang JI, Lee SM, Lee G, Lee HJ, Kim MK, Cha YJ. 2008. A Survey of Staphylococcus aureus contamination and antibiotic susceptibility in retail meat. J Korean Soc Food Sci Nutr 34:528-533.
    CrossRef

Korean Journal of
Veterinary Service

eISSN 2287-7630
pISSN 1225-6552
qr-code Download