Top
Search 닫기

Original Article

Split Viewer

Korean J. Vet. Serv. 2024; 47(1): 9-17

Published online March 30, 2024

https://doi.org/10.7853/kjvs.2024.47.1.9

© The Korean Socitety of Veterinary Service

전북지역 돼지유행성설사 바이러스 Spike 유전자분석

강미선*ㆍ정우리ㆍ양승혁ㆍ추금숙

전라북도 동물위생시험소

Received: November 23, 2023; Revised: January 22, 2024; Accepted: January 23, 2024

Sequence analysis of spike genes of porcine epidemic diarrhea virus (PEDV) from Jeonbuk province

Mi Seon Kang *, Woo Ri Jung , Seung Hyuck Yang , Keum Suk Chu

Jeollabuk-do Institute of Livestock & Veterinary Research, Jangsu 55632, Korea

Correspondence to : Mi Seon Kang
E-mail: sunny1201@korea.kr
https://orcid.org/0009-0005-6675-3771

Received: November 23, 2023; Revised: January 22, 2024; Accepted: January 23, 2024

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Porcine epidemic diarrhea (PED) is a highly contagious enteric viral disease of pigs with watery diarrhea in piglets, which ultimately results in huge economic losses in the swine industry. The spike (S) protein plays an important role in viral pathogenicity, tissue tropism, infection, dissemination and the trypsin-dependent proliferation of the PED virus (PEDV). In the present study, we determined the full-length spike (S) gene sequences of twenty PEDV field strains detected in Jeonbuk province in 2022. Phylogenetic analysis showed that the twenty PEDV field strains were classified into G2b group and shared 98.6∼100% of nucleotide homology and 97.4∼100% of amino acid homology with each other. Mutations of amino acid sequences on the neutralizing epitope of S protein were observed in the twenty field strains compared to the previous vaccine strain SM-98-1 (G1a group). Therefore, these amino acid mutations in the PEDV S protein may result in a new genotype of the virus and highly pathogenic virus, so continuous monitoring is required.

Keywords PEDV, Spike gene, RT-PCR, Phylogenetic analysis

돼지유행성설사(Porcine epidemic diarrhea, PED)는 돼지에서 전염성이 강한 급성 바이러스성 소화기질환으로 주로 포유자돈의 소장융모와 상피세포의 세포질내에서 증식하여 융모상피의 변성 및 괴사, 융모의 위축과 탈락을 일으켜 흡수장애를 초래하고, 지속적인 수양성 설사로 전해질의 고갈과 탈수로 자돈을 폐사시킨다(Debouck과 Pensaert, 1980). 모든 연령대의 돼지가 감염되지만, 특히 자돈에 감염되었을 경우 50∼100%의 높은 치사율을 보이기 때문에 양돈 농가에 심각한 경제적 손실을 야기하고 있다(Pijpers 등, 1993). PEDV는 1971년 영국에서 최초 보고된 이후, 유럽, 아시아, 북미 및 남미 등 대부분의 국가에서 가장 치명적인 돼지 바이러스성 질병 중 하나로 보고되어 있다. 국내에서는 1992년 첫 발생보고 이후 2010년까지 매년 꾸준히 발생하고 있고(Kweon 등, 1993; Pijpers 등, 1993), 2010년∼2011년 구제역의 발생으로 방역지역 살처분과 전국적인 소독 등의 활발한 방역활동으로 발생이 감소하였다. 그러나 2013년 11월경 PED의 확산으로 국내뿐만 아니라 세계적으로 양돈산업에 심각한 경제적 피해가 발생하였다(Lee와 Lee, 2014; Lee, 2015). 또한 양돈산업에서 백신의 효능에 대한 의문이 제기되었고 PED 바이러스의 변이와 백신의 효능이 주목받게 되었다.

PED의 원인체는 CoronaviridaeAlphacoronavirus 속에 속하는 대형의 외피를 가지는 RNA 바이러스로, PEDV 게놈은 4개의 구조 단백질(Spike [S], Envelope [E], Membrane [M] 및 Nucleocapsid [N])과 3개의 비구조 단백질(replicase 1a, replicase 1b 및 ORF3)을 암호화하고 있다(Duarte 등, 1993). PEDV의 S protein은 바이러스의 주요 envelopeⅠ glycoprotein으로서, 세포 수용체와 상호작용하여 바이러스의 유입을 매개하고 자연 숙주의 항체 중화 유도를 자극하는 역할을 한다(Chang 등, 2002). 따라서, 가장 많은 아미노산의 변형이 축적되어 있는 N-terminal region을 포함한 PEDV S glycoprotein은 발현 위치 및 기능으로 인하여 PEDV의 항원성에 결정적인 역할을 하며 PEDV 분리주들 사이의 유전적 연관성과 특성을 판단하고, 유효한 백신 개발에 활용하기 적합한 바이러스 유전자로 알려져 있다(Lee 등, 2010; Oh 등, 2014). 세계적인 PEDV의 발생 보고를 보면 G2b strain이 주로 보고되고 있고(Tran 등, 2021), 국내에도 G2b strain이 주로 유행하고 있다(Park 등, 2016; Park 등, 2021).

국가가축방역통합시스템(KAHIS)에서 전라북도는 2000년 8호 1,913두가 감염이 보고된 후 2014년 21호 4,500두 감염, 2022년 45호 11,955두가 감염되어 지속적으로 발생하고 있다. 특히, 2022년 PED의 발생률이 높아 본 연구에서는 2022년 전북지역 PED 발생 농가에서 분리한 PEDV S gene의 뉴클레오타이드 및 아미노산 염기서열을 분석하고, 기 보고된 국내 및 해외 분리주와 백신주간 유전적 특성을 비교 분석하여 발생농가의 백신접종을 위한 지도자료로 활용하고자 연구를 실시하였다.

시료채취 및 RNA 추출

2022년 전북지역에서 PED로 진단된 20농가의 분변 및 장 조직 유제를 PBS에 10% W/V로 3,000 rpm에서 10분간 원심분리 후 상층액을 채취하였다. 이 상층액을 HiQ Viral DNA/RNA kit (Bio-D, Korea)를 이용하여 제조사가 제시한 실험 방법에 따라 RNA를 추출하여 실험에 사용하였다.

RT-PCR 검사

PEDV S gene의 증폭에 사용한 primer는 Park 등(2016)과 동일하게 합성하였으며, 합성한 primer로 증폭이 안되는 부위는 Genbank의 data (JN599150)를 기초로 primer를 제작하여 사용하였다(Cosmo-genetech, Korea). 추출한 nucleotides는 RT-PCR premix (Maxime RT-PCR premix, iNtRON)를 이용하여 50℃ 30분, 94℃ 5분간 1회, 94℃ 30초, 50℃ 40초, 72℃ 1분 30초간 40회, 72℃ 10분간 1회 증폭하였다. 증폭산물은 1.5% agarose gel에서 전기영동 후 Midori Green Advance DNA Stain으로 염색하여 band를 확인하였다. PEDV 염기서열의 분석은 Gel extraction kit를 사용하여 정제한 후 Cosmo-genetech DNA sequencing service (Cosmo, Korea)에 의뢰하여 실시하였다(Table 1).

Table 1 . List of primers utilized in this study

PrimerNucleotide sequence, 5’→3’Length (bp)PositionAccession number
PEDVS1-FCCATTAGTGATGTTGTGTTAG1,03120,535JN599150
PEDVS1-RGCACAGCAGCTCCATT21,565
PEDVS2-FCCACATACCAGAAGGTTTTAG1,14621,372JN599150
PEDVS2-RCCAGTAATCAACTCACCCTT22,517
PEDVS3-FCCCTGAGTTTGGTAGTGG1,13422,466JN599150
PEDVS3-RCATCCGTCTGTAGAGCAAG23,599
PEDVS3-F2TGGTCATAGTGGTGCCAACC1,41922,163JN599150
PEDVS3-R2TTGCGCTGTAGAACATCCGT23,581
PEDVS4-FCTCATCGGTGGTATGGTGCT1,35523,497JN599150
PEDVS4-RAGCAGACTTTGAGACATCTTTGAC24,851
PEDVS5-FACTCTGGTGTCATGGTAC1,49023,433JN599150
PEDVS5-RATTGCGCCTCAAAGAAGACG24,922


다중 정렬 및 계통학적 분석

국내에서 유행하는 PEDV와 기존에 보고된 PEDV의 S 유전자를 분석하기 위하여 BioEdit 7.2.5.0을 사용하였으며, 염기서열과 아미노산 서열 다중 정렬을 통해 상동성을 비교하여 백분위로 나타냈다. 계통학적 분석을 위하여 MEGA software version 11 (Tamura 등, 2021)을 이용하여 neighbor-joining (NJ) method로 1,000회의 bootstrap을 실시하여 계통수를 생성하였으며, 분석된 유전자 서열은 GenBank에 공개된 자료와 비교하였다(Table 2, 3).

Table 2 . The recent porcine epidemic diarrhea virus (PEDV) analyzed in this study

StrainAreaBreeding scale (pigs)Damage situation (pigs)Country and yearGenBank accession number
JBBI03Iksan3,000110Korea, 2022PP146383
JBBI04Iksan3,300108Korea, 2022PP146384
JBBI05Iksan2,70088Korea, 2022PP146385
JBBG31Gunsan2,10040Korea, 2022PP146386
JBBG33Gunsan1,70030Korea, 2022PP146387
JBBG32Gunsan2,300100Korea, 2022PP146388
JBBG38Gunsan1,50080Korea, 2022PP146389
JBBG42Gunsan1,600109Korea, 2022PP146390
JBBG34Gunsan2,000300Korea, 2022PP146391
JBBI11Iksan65027Korea, 2022PP146392
JBBI20Iksan75066Korea, 2022PP146393
JBBI27Iksan3,500449Korea, 2022PP146394
JBBK41Kimje5,700120Korea, 2022PP146395
JBSJ10Jeongeup2,200350Korea, 2022PP146396
JBSJ24Jeongeup10,200359Korea, 2022PP146397
JBSJ44Jeongeup3,700133Korea, 2022PP146398
JBSK22Gochang2,200300Korea, 2022PP146399
JBSK07Gochang2,400650Korea, 2022PP146400
JBSJ06Jeongeup1,800862Korea, 2022PP146401
JBSJ08Jeongeup1,700400Korea, 2022PP146402


Table 3 . The reference porcine epidemic diarrhea virus (PEDV) strains analyzed in this study

StrainCountry and yearGenBank accession number
CV777Belgium, 1978AF353511
CH SChina, 1986JN547228
SM98Korea, 1998GU937797
Virulent DR13Korea, 1999JQ023161
Attenuated DR13Korea, 2003JQ023162
TGEVUSA, 2006DQ811788
LZCChina, 2006EF185992
JS2008China, 2008KC210146
KNU-0802Korea, 2008GU180143
KNU-0801Korea, 2008GU180142
KNU-0901Korea, 2009GU180144
AJ1102China, 2011JX188454
CHGD-01China, 2011JX261936
ZJCZ4China, 2011JX524137
BJ-2011-1China, 2011JN825712
CH ZMDZY 11China, 2011KC196276
CH FJND-3China, 2011JQ282909
GD-AChina, 2012JX112709
LCChina, 2012JX489155
AH2012China, 2012KC210145
JS-HZ2012China, 2012KC210147
GD-BChina, 2012JX088695
SD-MChina, 2012JX560761
GD-1China, 2012JX647847
Attenuated vaccineChina, 2013KC189944
IA1USA, 2013KF468753
IA2USA, 2013KF468754
13-019349USA, 2013KF267450
Iowa106USA, 2013KJ645695
OH851USA, 2014KJ399978
QIAP1401*Korea, 2014KX793713
KNU 1409-1Korea, 2013KJ741221
KNU-1701Korea, 2017MH052680
KNU-1708Korea, 2017MH052687
KNU-1710Korea, 2017MH052689
KNU-1806Korea, 2018MH243318
KNU-1904Korea, 2019MN971595
KNU-1909Korea, 2019MN844888

*Korean PEDV vaccine strains.


PEDV S 유전자의 염기서열 및 아미노산 분석

본 연구에서 확보된 20주의 PEDV S 유전자 전체 염기서열을 분석한 결과, 4,160 bp 길이의 nucleotide로 구성되어 있었으며 1,386개의 아미노산을 암호화하고 있었다. 각 염기서열과 아미노산 상동성을 분석한 결과, 분리주간 염기서열 상동성은 98.6∼100%, 아미노산 상동성은 97.4∼100%의 상동성을 보였다. GenBank의 data (Table 3)와 분석 결과, 가장 높은 상동성을 보이는 주는 IA2 (미국, 2013)로 염기서열 상동성은 98.3∼99.3%, 아미노산 상동성은 97.1∼99.4%로 나타났다. 국내에서 상용되는 백신주(SM-98-1, DR-13, QIAP1401)와의 염기서열 및 아미노산 상동성은 QIAP1401주가 각각 98.2∼99.3%, 97.1∼99.4%로 가장 높은 상동성을 보였고, SM-98-1과 DR-13주는 각각 92.1∼93.2%, 92.5∼93.6%의 염기서열 상동성과 89.7∼92.3%, 90.6∼93.1%의 아미노산 상동성을 보였다(Table 4). S 유전자의 N-terminal region을 SM-98주와 CV777을 기준으로 비교 분석한 결과 56∼59번 위치에서 4개의 아미노산 삽입, 115∼118번 위치에서 4개의 결손, 140번 위치에서 1개의 삽입, 160∼161번 위치에서 2개의 결손이 존재하였다(Fig. 1).

Table 4 . Comparison of the nucleotide and deduced amino acid sequences of S genes of PEDV references strains and PEDV isolates in Jeonbuk

Virus strain123456789101112131415161718192021222324252627
1. SM98/Korea/199898.892.394.092.394.996.789.792.192.192.292.292.292.292.292.292.192.392.292.292.292.392.092.292.292.192.2
2. CV777/belgium/197896.393.595.293.596.198.090.993.393.393.493.493.493.493.493.493.393.593.493.493.493.593.293.493.493.393.4
3. QIAP1401/Korea/201493.393.895.999.993.294.597.199.199.199.399.399.399.399.399.399.199.199.399.399.499.299.199.499.399.399.4
4. KNU-1409-1/Korea/201394.495.196.795.995.396.793.495.695.695.895.895.895.895.895.895.695.695.895.895.895.795.695.895.895.795.8
5. IA2/USA/201393.393.899.896.693.194.597.199.199.199.399.399.399.399.399.399.199.199.399.399.499.299.199.499.399.399.4
6. attenuated DR13/Korea/201396.399.993.895.293.998.290.692.992.993.193.193.193.193.193.192.993.093.193.193.193.092.993.193.192.993.1
7. virulent DR13/Korea/199997.998.394.996.395.098.491.994.394.394.494.494.494.494.494.494.394.394.494.494.494.394.294.494.494.394.4
8. JBBI0392.192.598.395.498.292.593.797.497.497.597.597.597.597.597.597.497.397.597.597.797.497.397.797.597.697.7
9. JBBI0493.093.499.396.499.293.594.698.699.799.999.999.999.999.999.9100.099.699.999.999.799.899.599.799.999.699.7
10. JBBI0593.093.599.296.399.293.694.798.699.899.999.999.999.999.999.999.799.699.999.999.799.899.599.799.999.699.7
11. JBBG3193.193.599.396.499.393.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
12. JBBG3393.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
13. JBBG3293.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
14. JBBG3893.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
15. JBBG4293.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
16. JBBG3493.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
17. JBBI1193.093.499.396.499.293.594.698.6100.099.899.999.999.999.999.999.999.699.999.999.799.899.599.799.999.699.7
18. JBBI2093.193.499.296.499.293.594.698.699.899.899.999.899.899.899.899.899.899.899.899.699.999.499.699.899.599.6
19. JBBI2793.193.599.396.499.393.694.798.699.999.9100.0100.0100.0100.0100.0100.099.999.9100.099.999.999.699.9100.099.799.9
20. JBBK4193.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.0100.099.999.8100.099.999.999.699.9100.099.799.9
21. JBSJ1093.293.699.396.599.393.694.899.099.699.699.799.699.699.699.699.699.699.699.799.699.899.6100.099.999.9100.0
22. JBSJ2493.193.599.396.499.393.694.798.699.999.9100.099.999.999.999.999.999.999.9100.099.999.799.699.899.999.699.8
23. JBSJ4493.093.499.296.499.193.594.798.899.599.599.599.599.599.599.599.599.599.599.599.599.899.599.699.699.599.6
24. JBSK2293.293.699.396.599.393.694.899.099.699.699.799.699.699.699.699.699.699.699.799.6100.099.799.899.999.9100.0
25. JBSK0793.193.599.396.499.393.694.798.699.999.9100.099.999.999.999.999.999.999.9100.099.999.799.999.599.799.799.9
26. JBSJ0693.193.599.396.599.293.694.798.999.699.599.699.699.699.699.699.699.699.599.699.699.999.699.799.999.699.9
27. JBSJ0893.293.699.396.599.393.694.899.099.699.699.799.699.699.699.699.699.699.699.799.6100.099.799.8100.099.799.9

The percent identify was shown in the lower left (nucleotide) and the upper right (deduced amino acid).



Fig. 1.Alignment of amino N-terminal 1-234 amino acid of spike (S) proteins between the reference strains and twenty PEDV field strains in Jeonbuk. The dashes (−) indicate the deleted sequences. Insertions and deletions within PEDV isolates are indicated by boxes (Red box indicate the inserted amino acids compared with SM-98 and CV777. Blue box indicates the deleted amino acids compared with SM-98 or CV777).

Phylogenetic tree 분석

PEDV S 유전자의 염기서열을 이용하여 국내외 분리주와 phylogenetic tree를 분석한 결과, 본 연구에서 분리된 20개 바이러스주 모두 Genogroup 2b (G2b) 계열에 속하였다. PEDV는 S gene의 계통학적 분류를 통해 2가지 유전형(G1, G2)으로 나뉘고 각각 2개 그룹은 G1a, G1b, G2a, G2b의 보조그룹으로 나뉜다. G2b 그룹은 국내 분리주(KNU-1708/2017, KNU-1909/2019, KNU-1406-1/2014 등)와 미국 분리주(13-019349/2013, IA1/2013, IA2/2013 등) 및 중국 분리주(AH2012/2012, BJ-2011-1/2011, GD-B/2012, GD-1/ 2011 등) 등 최근에 유행하는 주가 속하였다. 국내에서 분리된 QIAP1401주 또한 G2b형으로 확인되었다. 국내 백신주로 많이 사용되고 있는 SM-98-1과 DR-13주는 G1 계열로 현재 유행하고 있는 PEDV와는 계통 발생학적으로 차이가 있음을 확인하였다(Fig. 2).

Fig. 2.Phylogenetic analysis based on the nucleotide sequence corresponding to the full-length S gene of PEDV strains. Sequencing alignments were performed using the Clustal W program, and the phylogenetic tree was constructed from the aligned nucleotide sequences by using the neighbor-joining method. The bootstrap values were determined from 1,000 replicates of original data. The scale bars indicate the number of 0.050 inferred substitutions per site. Putative similar regions of S gene of other distantly related coronavirus, transmissible gastroenteritis virus (TGEV), was also included in this study.

S 유전자의 항원성 분석

S 유전자의 항원성에 대한 변이를 조사하기 위해 neutralizing epitope으로 밝혀진 COE (503∼642 aa), SS2 (752∼759 aa), SS6 (768∼775 aa), 2C10 (1,372∼1,378 aa) 부위를 초기 백신주 SM-98-1주와 비교 분석하였다. COE domain에서, 분리된 18주 모두 변이된 부위는 10개(L→S at 507, A→S at 521, L→H at 525, S→G at 527, V→I at 531, T→S at 553, G→S at 598, A→E at 609, L→F at 616, I→V at 639)였으며, 국내 백신주 QIAP1041과 비교 결과 같은 변이부위가 확인되었다. 20개 중 2개의 분리주(JBBI20, JBSJ24)에서는 1개 부위(L→H at 525)에서 변이가 보이지 않았다. 2주(JBBI04, JBBI11)에서 1개(Y→I at 531)의 부위, 1주(JBSJ44)에서 1개(P→Y at 555) 부위에서 변이가 관찰되었다. SS6 region에서는 분리된 20주 모두 2개(P→S at 768, Y→S at 770) 부위에서 아미노산 변이가 관찰되었으며, SS2와 2C10에서는 어떠한 변이도 관찰되지 않았다(Fig. 3).

Fig. 3.Comparison of the antigen epitopes between field strains and reference strains. Dots indicate the amino acids are identical to those of reference strain SM-98-1. COE is in the red box, SS2 is in the blue box, SS6 is in the green box and the against 2C10 is in the orange box. The mutated amino acids within PEDV isolates are indicated by boxes and circles. Black box indicates the mutated amino acids compared with SM-98-1.

국가가축방역통합시스템에 의하면 PED는 2014년 전국적으로 114호 21,260두의 발생 보고 이후 2018년 221호 34,716두, 2022년 233호 21,086두가 발생하는 등 백신 실시에도 불구하고 좀처럼 발생이 감소하지 않고 있다. 자돈의 경우 설사 및 탈수로 인해 생후 1주 미만의 자돈은 폐사율이 높고, 모돈도 자돈 폐사로 인한 포유 중단으로 불규칙한 발정과 산자수 감소 등 번식성적 감소를 유발하며, 발생농가는 질병이 쉽게 근절되지 않아 정상적인 모돈의 번식 능력을 회복하는데 시간과 노력이 요구된다.

코로나바이러스의 구조 protein 중 바이러스의 외피의 바깥층에 위치하여 가장 먼저 숙주 세포와 접촉하고 숙주세포의 침입에 결정적 역할을 하는 spike (s) protein은 유전적 다양성을 결정하는 중요한 단백질이다. 혈청학적으로 PEDV는 단일 혈청형이지만, S gene의 계통학적 분류를 통해 2가지 유전형(G1, G2)으로 나눌 수 있다. G1은 기존 백신주 및 세포적응주 등의 고전형(classical strain) 바이러스들이 속해 있고, G2는 야외유행주(epidemic strain) 및 대유행주(pandemic strain)가 포함되어 있다. 각각의 그룹은 2개의 보조그룹으로 나뉘어 G1은 고전주 아형그룹인 G1a와 G1a/G2b의 재조합 형태인 G1b로, G2 그룹은 고병원성으로 2013년 대유행 이전 야외주 G2a 및 대유행주 유래 최근 야외주 G2b로 구성되어 있다(Lee 등, 2010). 세계적으로 G1b strain 및 G2b strain의 발생이 보고되고 있지만, G2b strain이 주로 유행하고 있고, 이는 국내에서도 마찬가지로 G2b strain의 PEDV가 유행하고 있다(Lee와 Lee, 2014; Kim 등, 2015).

본 연구에서 분리된 20주의 S 유전자 염기서열 및 아미노산 분석 결과, 최근 발생 보고된 국내 야외주들과 같이 G2b 그룹으로 분류되었으며, 분리주간 염기서열 상동성은 98.6∼100%, 아미노산 상동성은 97.4∼100%로 높은 상동성을 가진 것으로 나타났다. 특히, JBBG31, JBBG33, JBBG32, JBBG38, JBBG42, JBBG34, JBBI27, JBBK41주는 유전자 분석 결과 100%의 상동성을 보였는데, 같은 지역 및 인접한 지역임을 고려할 때 같은 바이러스의 유행하는 것으로 추정할 수 있고, Park 등(2021)이 보고한 결과와 같은 것으로 보아 전북지역 양돈 밀집사육 지역의 PEDV의 지속적인 감염을 추정할 수 있으며, 양돈 밀집 지역은 농가단위 방역보다 취약대상을 포함한 집중 방역조치가 필요한 것으로 생각된다.

국내에서는 2000년 초부터 국내분리주인 SM98-1과 DR-13주의 G1그룹을 이용한 약독화백신과 사독백신을 사용해 왔으나 2013년∼2014년부터 유행하는 타입은 G2b 그룹으로, 이는 미국 분리주와 유사성이 높은 것으로 보고 되었다(Lee와 Lee, 2014; Lee 등, 2015). 본 연구에서 분리된 20주의 계통분석 결과 G2b의 그룹으로 확인되어, G1그룹인 SM-98주 및 DR-13주와는 다른 그룹을 형성하고 있었으며 염기서열 및 아미노산 서열 비교 결과, 염기서열에서는 각각 6.8∼7.9%, 6.4∼7.5%, 아미노산에서는 각각 7.7∼10.3%, 6.9∼9.4%의 차이를 보였다. 반면에 국내 백신주인 QIAP1401주와의 비교에서는 같은 G2b그룹으로 0.7∼1.8%, 아미노산 서열은 0.6∼2.9%의 차이로 나타나 높은 일치율을 보였다. PEDV S protein은 1,383에서 1,386의 아미노산으로 구성되어 있고, 바이러스와 숙주 세포 사이의 수용체 결합영역(receptor-binding domain)을 가지고 있는 S1 subunit (1∼789 aa)과 바이러스 외피에 spike를 고정하고 단백질 분해효소(protease) 활성화 시 융합을 가능하게 줄기를 형성하는 S2 subunit (790∼1,383 aa) 두부분으로 나뉠 수 있다(Sun 등, 2007; Deng 등, 2016). S1 subunit에 포함된 아미노산의 변형이 가장 많은 N-terminal region이 PEDV의 항원성에 결정적인 역할을 하며 PEDV 분리주들 사이의 유전적 연관성과 특성을 판단하고, 유효한 백신 개발에 활용하기 적합한 바이러스 유전자로 알려져 있다(Lee 등, 2010; Oh 등, 2014).

본 연구에서 분리된 20주와 초기 백신주인 CV777, SM-98-1주의 N-terminal region을 비교한 결과 56∼59번 위치에서 4개의 아미노산 삽입, 140번 위치에서 1개의 아미노산 삽입, 160∼161번 위치에서 2개의 결손이 존재하여 Lee 등(2010)이 보고한 G2그룹의 유전적 특징과 같은 결과를 얻을 수 있었다. 또한, 중화항체 생성에 관여하는 것으로 알려진 neutralizing epitope (COE, SS2, SS6, 2C10) 부위를 초기 국내 백신주 SM-98-1과 비교 결과, COE 부위에서는 18개의 분리주에서 모두 변이가 관찰된 10개 부위를 포함해 11개 부위에서 변이가 보였고, 2개의 분리주에서는 9개의 변이가 관찰되었다. SS6에서는 20개 분리주가 2개 부위에서 모두 변이 되었으나, SS2와 SS10에서는 변이가 관찰되지 않았다(Sun 등, 2012; Park 등, 2016). 이러한 S 유전자에서의 변이는 PEDV 균주의 유전적 진화와 병원성을 밝히는데 중요하고 특히 S1 subunit의 COE 및 SS6 부위는 야외 PEDV의 다양성을 나타내며 염기서열의 삽입, 결손 및 항원 부위의 변이는 바이러스의 항원성 및 중화 작용에 변화를 유발할 수 있기에, PEDV 변이주의 출현 계기가 될 수 있다(Lin 등, 2016).

농림축산검역본부에서는 매년 전국의 모돈의 혈청에서 최근 유행하는 PEDV G2b 타입에 대한 항체가 조사를 실시하고 있다. 이는 PEDV에 치명적인 자돈에서 모체항체가 태반을 통과하지 못하기 때문에 초유를 통해 자돈의 방어효과를 확인하기 위한 것으로 모돈의 방어항체가 64배 이상이 되어야 자돈에서 방어가 가능하다(Langel 등, 2016). 초유의 면역을 증강시키기 위해 국내에서는 2000년대 초 PED 백신 출시 이후 분만전 2∼3주 간격으로 임신 모돈에 생독-사독-사독의 접종 프로그램이 권장되어 왔다. 특히, PED 음성 돈군 또는 상재화 돈군의 경우, 사독백신 만으로는 중화항체 형성 및 방어 효과가 부족하기 때문에 생독-사독-사독 백신 프로그램의 지속 적용이 추천되고 있다. 2013년 말부터 현재까지 유행하는 G2b 타입의 PEDV를 분리하여 PED 불활화백신과 생백신이 개발되어 사용하고 있고 최근에는 경구접종 및 근육접종 모두 가능한 생백신이 출시되어 양돈농가에서 사용되고 있으나, 인공감염을 선호하거나 기존 1세대 G1a 백신을 접종하는 농가도 있는 실정이다. 인공감염으로 사용되는 바이러스는 병원성이 높은 G2b 타입의 바이러스로 농장 전체에 병원성이 높은 바이러스가 오염되어 지속적으로 질병을 유발할 수 있고, 기존 G1a 그룹 생독 백신(SM-98-1 및 DR-13주)의 사용은 숙주 내에서 충분치 못한 면역 유도로 야외에서 순환하고 있는 G2b 바이러스의 변이와 재조합 등을 유발할 수 있다(Lee, 2015; Lin 등, 2016). 따라서, 국내 발생 중인 PED의 효과적인 예방을 위해서는 현재 유행하는 타입에 맞는 G2b타입의 백신을 사용해야 하고 농장간 철저한 차단방역을 실시해야 한다. 또한 유전자 염기서열 분석을 통해 유행하는 PEDV의 유전적 변이에 대한 지속적인 모니터링이 필요할 것으로 사료된다.

2022년 전북지역에서 PED로 확인된 20개의 시료를 대상으로 PEDV S 유전자를 증폭하여 유전적 특성을 비교 분석하였다. 분리한 20개의 PEDV S 유전자 전체 염기서열 분석 결과, G2b 타입으로 분류되었고, 분리주간 염기서열은 98.6∼100.0%, 아미노산은 97.4∼100.0%의 높은 유전적 상동성을 보였다. 국내의 상용 백신주(SM-98-1, DR-13, QIAP1401)와 염기서열 및 아미노산 상동성을 비교한 결과, QIAP1401주와는 98.2∼99.3% (97.1∼99.4%)로 높은 상동성을 보였으나 SM-98-1 및 DR-13주와는 92.1∼93.6% (89.7∼93.1%)의 낮은 일치율을 보였다. 20주의 전북 PEDV 분리주와 백신주의 중화항체 유도부위(COE, SS2, SS6, 2C10)에 대한 비교 결과, 분리주에 따라 SM-98-1주 대비 10∼14개의 아미노산 변이가 확인되었다. PEDV S protein의 아미노산 변이는 변이주의 출현에 기회를 제공할 수 있으므로 지속적인 모니터링이 필요하며, 유행하는 PEDV의 유전형에 따른 새로운 백신도 계속해서 개발되어져야 할 것이다.

No potential conflict of interest relevant to this article was reported.

  1. Chang SH, Bae JL, Kang TJ, Kim J, Chung GH, Lim CW, Laude H, Jang YS. 2002. Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus. Mol Cells 14:295-299.
    Pubmed CrossRef
  2. Debouck P and Pensaert M. 1980. Experimental infection of pigs with a new porcine enteric coronavirus, CV 777. Am J Vet Res 41:219-223.
  3. Duarte M, Gelfi J, Lambert P, Laude H. 1993. Genome organization of porcine epidemic diarrhoea virus. Adv Exp Med Biol 342:55-60.
    Pubmed CrossRef
  4. Kim SH, Lee JM, Jung J, Kim IJ, Hyun BH, Kim HI, Park CK, Oem JK, Kim YH, Lee KK. 2015. Genetic characterization of porcine epidemic diarrhea virus in Korea from 1998 to 2013. Arch Virol 160:1055-1064.
    Pubmed KoreaMed CrossRef
  5. Kweon CH, Kwon BJ, Jung TS, Kee YJ, Hur DH, Hwang EK, An SH. 1993. Isolation of porcine epidemic diarrhea virus (PEDV) in Korea. Korean J Vet Res 33:249-254.
  6. Langel SN, Paim FC, Lager KM, Saif LJ. 2016. Lactogenic immunity and vaccines for porcine epidemic diarrhea virus (PEDV): Historical and current concepts. Virus Res 226:93-107.
    Pubmed KoreaMed CrossRef
  7. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Higgins DG. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2947-2948.
    Pubmed CrossRef
  8. Lee CH. 2015. Porcine epidemic diarrhea virus: An emerging and re-emerging epizootic swine virus. Virol J 12:193.
    Pubmed KoreaMed CrossRef
  9. Lee DK, Park CK, Lee C. 2010. Heterogeneity in spike protein genes of porcine epidemic diarrhea viruses isolated in Korea. Virus Res 149:175-182.
    Pubmed KoreaMed CrossRef
  10. Lee SH and Lee CH. 2014. Outbreak-related porcine epidemic diarrhea virus strains similar to US strains, South Korea, 2013. Emerg Infect Dis 20:1223-1226.
    Pubmed KoreaMed CrossRef
  11. Lin CM, Saif LJ, Wang Q. 2016. Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains. Virus Res 226:20-39.
    Pubmed KoreaMed CrossRef
  12. Madson DM, Magstadt DR, Arruda PH, Hoang H, Sun D, Bower LP, Bhandari M, Burrough ER, Pillatzki AE, et al. 2014. Pathogenesis of porcine epidemic diarrhea virus isolate (US/Iowa/18984/2013) in 3-week-old weaned pigs. Vet Microbiol 174:60-68.
    Pubmed CrossRef
  13. Oh J, Lee KW, Lee CJ. 2014. Immunogenicity and protective efficacy of recombinant S1 domain of the porcine epidemic diarrhea virus spike protein. Arch Virol 159:2977-2987.
    Pubmed KoreaMed CrossRef
  14. Park HS, Yook SY, Jeon DM, Shin CH. 2016. Genetic sequence and phylogenetic analysis of spike genes of porcine epidemic diarrhea virus (PEDV) in Chung-Nam area. Korean J Vet Serv 39:259-266.
    CrossRef
  15. Park MY, Moon BM, Gang SJ, Lee JH, Park JW, Her CH. 2021. Genetic sequence and phylogenetic analysis of spike genes of porcine epidemic diarrhea virus (PEDV) in Jeonbuk province. Korean J Vet Serv 44:73-83.
  16. Pijpers A, van Nieuwstadt AP, Verheijden JH. 1993. Porcine epidemic diarrhoea virus as a cause of persistent diarrhoea in a herd of breeding and finishing pigs. Vet Rec 132:129-131.
    Pubmed CrossRef
  17. Sun RQ, Cai RJ, Chen YQ, Liang PS, Song CX. 2012. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerg Infect Dis 18:161-163.
    Pubmed KoreaMed CrossRef
  18. Tamura K, Kumar S. 2021. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022-3027.
    Pubmed KoreaMed CrossRef
  19. Tran TX, Lien NTK, Thu HT, Duy ND, Quyen DV. 2021. Changes in the spike and nucleocapsid protein of porcine epidemic diarrhea virus strain in Vietnam-a molecular potential for the vaccine development? PeerJ 9:e12329.
    Pubmed KoreaMed CrossRef

Article

Original Article

Korean J. Vet. Serv. 2024; 47(1): 9-17

Published online March 30, 2024 https://doi.org/10.7853/kjvs.2024.47.1.9

Copyright © The Korean Socitety of Veterinary Service.

전북지역 돼지유행성설사 바이러스 Spike 유전자분석

강미선*ㆍ정우리ㆍ양승혁ㆍ추금숙

전라북도 동물위생시험소

Received: November 23, 2023; Revised: January 22, 2024; Accepted: January 23, 2024

Sequence analysis of spike genes of porcine epidemic diarrhea virus (PEDV) from Jeonbuk province

Mi Seon Kang *, Woo Ri Jung , Seung Hyuck Yang , Keum Suk Chu

Jeollabuk-do Institute of Livestock & Veterinary Research, Jangsu 55632, Korea

Correspondence to:Mi Seon Kang
E-mail: sunny1201@korea.kr
https://orcid.org/0009-0005-6675-3771

Received: November 23, 2023; Revised: January 22, 2024; Accepted: January 23, 2024

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Porcine epidemic diarrhea (PED) is a highly contagious enteric viral disease of pigs with watery diarrhea in piglets, which ultimately results in huge economic losses in the swine industry. The spike (S) protein plays an important role in viral pathogenicity, tissue tropism, infection, dissemination and the trypsin-dependent proliferation of the PED virus (PEDV). In the present study, we determined the full-length spike (S) gene sequences of twenty PEDV field strains detected in Jeonbuk province in 2022. Phylogenetic analysis showed that the twenty PEDV field strains were classified into G2b group and shared 98.6∼100% of nucleotide homology and 97.4∼100% of amino acid homology with each other. Mutations of amino acid sequences on the neutralizing epitope of S protein were observed in the twenty field strains compared to the previous vaccine strain SM-98-1 (G1a group). Therefore, these amino acid mutations in the PEDV S protein may result in a new genotype of the virus and highly pathogenic virus, so continuous monitoring is required.

Keywords: PEDV, Spike gene, RT-PCR, Phylogenetic analysis

서 론

돼지유행성설사(Porcine epidemic diarrhea, PED)는 돼지에서 전염성이 강한 급성 바이러스성 소화기질환으로 주로 포유자돈의 소장융모와 상피세포의 세포질내에서 증식하여 융모상피의 변성 및 괴사, 융모의 위축과 탈락을 일으켜 흡수장애를 초래하고, 지속적인 수양성 설사로 전해질의 고갈과 탈수로 자돈을 폐사시킨다(Debouck과 Pensaert, 1980). 모든 연령대의 돼지가 감염되지만, 특히 자돈에 감염되었을 경우 50∼100%의 높은 치사율을 보이기 때문에 양돈 농가에 심각한 경제적 손실을 야기하고 있다(Pijpers 등, 1993). PEDV는 1971년 영국에서 최초 보고된 이후, 유럽, 아시아, 북미 및 남미 등 대부분의 국가에서 가장 치명적인 돼지 바이러스성 질병 중 하나로 보고되어 있다. 국내에서는 1992년 첫 발생보고 이후 2010년까지 매년 꾸준히 발생하고 있고(Kweon 등, 1993; Pijpers 등, 1993), 2010년∼2011년 구제역의 발생으로 방역지역 살처분과 전국적인 소독 등의 활발한 방역활동으로 발생이 감소하였다. 그러나 2013년 11월경 PED의 확산으로 국내뿐만 아니라 세계적으로 양돈산업에 심각한 경제적 피해가 발생하였다(Lee와 Lee, 2014; Lee, 2015). 또한 양돈산업에서 백신의 효능에 대한 의문이 제기되었고 PED 바이러스의 변이와 백신의 효능이 주목받게 되었다.

PED의 원인체는 CoronaviridaeAlphacoronavirus 속에 속하는 대형의 외피를 가지는 RNA 바이러스로, PEDV 게놈은 4개의 구조 단백질(Spike [S], Envelope [E], Membrane [M] 및 Nucleocapsid [N])과 3개의 비구조 단백질(replicase 1a, replicase 1b 및 ORF3)을 암호화하고 있다(Duarte 등, 1993). PEDV의 S protein은 바이러스의 주요 envelopeⅠ glycoprotein으로서, 세포 수용체와 상호작용하여 바이러스의 유입을 매개하고 자연 숙주의 항체 중화 유도를 자극하는 역할을 한다(Chang 등, 2002). 따라서, 가장 많은 아미노산의 변형이 축적되어 있는 N-terminal region을 포함한 PEDV S glycoprotein은 발현 위치 및 기능으로 인하여 PEDV의 항원성에 결정적인 역할을 하며 PEDV 분리주들 사이의 유전적 연관성과 특성을 판단하고, 유효한 백신 개발에 활용하기 적합한 바이러스 유전자로 알려져 있다(Lee 등, 2010; Oh 등, 2014). 세계적인 PEDV의 발생 보고를 보면 G2b strain이 주로 보고되고 있고(Tran 등, 2021), 국내에도 G2b strain이 주로 유행하고 있다(Park 등, 2016; Park 등, 2021).

국가가축방역통합시스템(KAHIS)에서 전라북도는 2000년 8호 1,913두가 감염이 보고된 후 2014년 21호 4,500두 감염, 2022년 45호 11,955두가 감염되어 지속적으로 발생하고 있다. 특히, 2022년 PED의 발생률이 높아 본 연구에서는 2022년 전북지역 PED 발생 농가에서 분리한 PEDV S gene의 뉴클레오타이드 및 아미노산 염기서열을 분석하고, 기 보고된 국내 및 해외 분리주와 백신주간 유전적 특성을 비교 분석하여 발생농가의 백신접종을 위한 지도자료로 활용하고자 연구를 실시하였다.

재료 및 방법

시료채취 및 RNA 추출

2022년 전북지역에서 PED로 진단된 20농가의 분변 및 장 조직 유제를 PBS에 10% W/V로 3,000 rpm에서 10분간 원심분리 후 상층액을 채취하였다. 이 상층액을 HiQ Viral DNA/RNA kit (Bio-D, Korea)를 이용하여 제조사가 제시한 실험 방법에 따라 RNA를 추출하여 실험에 사용하였다.

RT-PCR 검사

PEDV S gene의 증폭에 사용한 primer는 Park 등(2016)과 동일하게 합성하였으며, 합성한 primer로 증폭이 안되는 부위는 Genbank의 data (JN599150)를 기초로 primer를 제작하여 사용하였다(Cosmo-genetech, Korea). 추출한 nucleotides는 RT-PCR premix (Maxime RT-PCR premix, iNtRON)를 이용하여 50℃ 30분, 94℃ 5분간 1회, 94℃ 30초, 50℃ 40초, 72℃ 1분 30초간 40회, 72℃ 10분간 1회 증폭하였다. 증폭산물은 1.5% agarose gel에서 전기영동 후 Midori Green Advance DNA Stain으로 염색하여 band를 확인하였다. PEDV 염기서열의 분석은 Gel extraction kit를 사용하여 정제한 후 Cosmo-genetech DNA sequencing service (Cosmo, Korea)에 의뢰하여 실시하였다(Table 1).

Table 1 . List of primers utilized in this study.

PrimerNucleotide sequence, 5’→3’Length (bp)PositionAccession number
PEDVS1-FCCATTAGTGATGTTGTGTTAG1,03120,535JN599150
PEDVS1-RGCACAGCAGCTCCATT21,565
PEDVS2-FCCACATACCAGAAGGTTTTAG1,14621,372JN599150
PEDVS2-RCCAGTAATCAACTCACCCTT22,517
PEDVS3-FCCCTGAGTTTGGTAGTGG1,13422,466JN599150
PEDVS3-RCATCCGTCTGTAGAGCAAG23,599
PEDVS3-F2TGGTCATAGTGGTGCCAACC1,41922,163JN599150
PEDVS3-R2TTGCGCTGTAGAACATCCGT23,581
PEDVS4-FCTCATCGGTGGTATGGTGCT1,35523,497JN599150
PEDVS4-RAGCAGACTTTGAGACATCTTTGAC24,851
PEDVS5-FACTCTGGTGTCATGGTAC1,49023,433JN599150
PEDVS5-RATTGCGCCTCAAAGAAGACG24,922


다중 정렬 및 계통학적 분석

국내에서 유행하는 PEDV와 기존에 보고된 PEDV의 S 유전자를 분석하기 위하여 BioEdit 7.2.5.0을 사용하였으며, 염기서열과 아미노산 서열 다중 정렬을 통해 상동성을 비교하여 백분위로 나타냈다. 계통학적 분석을 위하여 MEGA software version 11 (Tamura 등, 2021)을 이용하여 neighbor-joining (NJ) method로 1,000회의 bootstrap을 실시하여 계통수를 생성하였으며, 분석된 유전자 서열은 GenBank에 공개된 자료와 비교하였다(Table 2, 3).

Table 2 . The recent porcine epidemic diarrhea virus (PEDV) analyzed in this study.

StrainAreaBreeding scale (pigs)Damage situation (pigs)Country and yearGenBank accession number
JBBI03Iksan3,000110Korea, 2022PP146383
JBBI04Iksan3,300108Korea, 2022PP146384
JBBI05Iksan2,70088Korea, 2022PP146385
JBBG31Gunsan2,10040Korea, 2022PP146386
JBBG33Gunsan1,70030Korea, 2022PP146387
JBBG32Gunsan2,300100Korea, 2022PP146388
JBBG38Gunsan1,50080Korea, 2022PP146389
JBBG42Gunsan1,600109Korea, 2022PP146390
JBBG34Gunsan2,000300Korea, 2022PP146391
JBBI11Iksan65027Korea, 2022PP146392
JBBI20Iksan75066Korea, 2022PP146393
JBBI27Iksan3,500449Korea, 2022PP146394
JBBK41Kimje5,700120Korea, 2022PP146395
JBSJ10Jeongeup2,200350Korea, 2022PP146396
JBSJ24Jeongeup10,200359Korea, 2022PP146397
JBSJ44Jeongeup3,700133Korea, 2022PP146398
JBSK22Gochang2,200300Korea, 2022PP146399
JBSK07Gochang2,400650Korea, 2022PP146400
JBSJ06Jeongeup1,800862Korea, 2022PP146401
JBSJ08Jeongeup1,700400Korea, 2022PP146402


Table 3 . The reference porcine epidemic diarrhea virus (PEDV) strains analyzed in this study.

StrainCountry and yearGenBank accession number
CV777Belgium, 1978AF353511
CH SChina, 1986JN547228
SM98Korea, 1998GU937797
Virulent DR13Korea, 1999JQ023161
Attenuated DR13Korea, 2003JQ023162
TGEVUSA, 2006DQ811788
LZCChina, 2006EF185992
JS2008China, 2008KC210146
KNU-0802Korea, 2008GU180143
KNU-0801Korea, 2008GU180142
KNU-0901Korea, 2009GU180144
AJ1102China, 2011JX188454
CHGD-01China, 2011JX261936
ZJCZ4China, 2011JX524137
BJ-2011-1China, 2011JN825712
CH ZMDZY 11China, 2011KC196276
CH FJND-3China, 2011JQ282909
GD-AChina, 2012JX112709
LCChina, 2012JX489155
AH2012China, 2012KC210145
JS-HZ2012China, 2012KC210147
GD-BChina, 2012JX088695
SD-MChina, 2012JX560761
GD-1China, 2012JX647847
Attenuated vaccineChina, 2013KC189944
IA1USA, 2013KF468753
IA2USA, 2013KF468754
13-019349USA, 2013KF267450
Iowa106USA, 2013KJ645695
OH851USA, 2014KJ399978
QIAP1401*Korea, 2014KX793713
KNU 1409-1Korea, 2013KJ741221
KNU-1701Korea, 2017MH052680
KNU-1708Korea, 2017MH052687
KNU-1710Korea, 2017MH052689
KNU-1806Korea, 2018MH243318
KNU-1904Korea, 2019MN971595
KNU-1909Korea, 2019MN844888

*Korean PEDV vaccine strains..


결 과

PEDV S 유전자의 염기서열 및 아미노산 분석

본 연구에서 확보된 20주의 PEDV S 유전자 전체 염기서열을 분석한 결과, 4,160 bp 길이의 nucleotide로 구성되어 있었으며 1,386개의 아미노산을 암호화하고 있었다. 각 염기서열과 아미노산 상동성을 분석한 결과, 분리주간 염기서열 상동성은 98.6∼100%, 아미노산 상동성은 97.4∼100%의 상동성을 보였다. GenBank의 data (Table 3)와 분석 결과, 가장 높은 상동성을 보이는 주는 IA2 (미국, 2013)로 염기서열 상동성은 98.3∼99.3%, 아미노산 상동성은 97.1∼99.4%로 나타났다. 국내에서 상용되는 백신주(SM-98-1, DR-13, QIAP1401)와의 염기서열 및 아미노산 상동성은 QIAP1401주가 각각 98.2∼99.3%, 97.1∼99.4%로 가장 높은 상동성을 보였고, SM-98-1과 DR-13주는 각각 92.1∼93.2%, 92.5∼93.6%의 염기서열 상동성과 89.7∼92.3%, 90.6∼93.1%의 아미노산 상동성을 보였다(Table 4). S 유전자의 N-terminal region을 SM-98주와 CV777을 기준으로 비교 분석한 결과 56∼59번 위치에서 4개의 아미노산 삽입, 115∼118번 위치에서 4개의 결손, 140번 위치에서 1개의 삽입, 160∼161번 위치에서 2개의 결손이 존재하였다(Fig. 1).

Table 4 . Comparison of the nucleotide and deduced amino acid sequences of S genes of PEDV references strains and PEDV isolates in Jeonbuk.

Virus strain123456789101112131415161718192021222324252627
1. SM98/Korea/199898.892.394.092.394.996.789.792.192.192.292.292.292.292.292.292.192.392.292.292.292.392.092.292.292.192.2
2. CV777/belgium/197896.393.595.293.596.198.090.993.393.393.493.493.493.493.493.493.393.593.493.493.493.593.293.493.493.393.4
3. QIAP1401/Korea/201493.393.895.999.993.294.597.199.199.199.399.399.399.399.399.399.199.199.399.399.499.299.199.499.399.399.4
4. KNU-1409-1/Korea/201394.495.196.795.995.396.793.495.695.695.895.895.895.895.895.895.695.695.895.895.895.795.695.895.895.795.8
5. IA2/USA/201393.393.899.896.693.194.597.199.199.199.399.399.399.399.399.399.199.199.399.399.499.299.199.499.399.399.4
6. attenuated DR13/Korea/201396.399.993.895.293.998.290.692.992.993.193.193.193.193.193.192.993.093.193.193.193.092.993.193.192.993.1
7. virulent DR13/Korea/199997.998.394.996.395.098.491.994.394.394.494.494.494.494.494.494.394.394.494.494.494.394.294.494.494.394.4
8. JBBI0392.192.598.395.498.292.593.797.497.497.597.597.597.597.597.597.497.397.597.597.797.497.397.797.597.697.7
9. JBBI0493.093.499.396.499.293.594.698.699.799.999.999.999.999.999.9100.099.699.999.999.799.899.599.799.999.699.7
10. JBBI0593.093.599.296.399.293.694.798.699.899.999.999.999.999.999.999.799.699.999.999.799.899.599.799.999.699.7
11. JBBG3193.193.599.396.499.393.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
12. JBBG3393.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
13. JBBG3293.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
14. JBBG3893.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
15. JBBG4293.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
16. JBBG3493.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
17. JBBI1193.093.499.396.499.293.594.698.6100.099.899.999.999.999.999.999.999.699.999.999.799.899.599.799.999.699.7
18. JBBI2093.193.499.296.499.293.594.698.699.899.899.999.899.899.899.899.899.899.899.899.699.999.499.699.899.599.6
19. JBBI2793.193.599.396.499.393.694.798.699.999.9100.0100.0100.0100.0100.0100.099.999.9100.099.999.999.699.9100.099.799.9
20. JBBK4193.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.0100.099.999.8100.099.999.999.699.9100.099.799.9
21. JBSJ1093.293.699.396.599.393.694.899.099.699.699.799.699.699.699.699.699.699.699.799.699.899.6100.099.999.9100.0
22. JBSJ2493.193.599.396.499.393.694.798.699.999.9100.099.999.999.999.999.999.999.9100.099.999.799.699.899.999.699.8
23. JBSJ4493.093.499.296.499.193.594.798.899.599.599.599.599.599.599.599.599.599.599.599.599.899.599.699.699.599.6
24. JBSK2293.293.699.396.599.393.694.899.099.699.699.799.699.699.699.699.699.699.699.799.6100.099.799.899.999.9100.0
25. JBSK0793.193.599.396.499.393.694.798.699.999.9100.099.999.999.999.999.999.999.9100.099.999.799.999.599.799.799.9
26. JBSJ0693.193.599.396.599.293.694.798.999.699.599.699.699.699.699.699.699.699.599.699.699.999.699.799.999.699.9
27. JBSJ0893.293.699.396.599.393.694.899.099.699.699.799.699.699.699.699.699.699.699.799.6100.099.799.8100.099.799.9

The percent identify was shown in the lower left (nucleotide) and the upper right (deduced amino acid)..



Figure 1. Alignment of amino N-terminal 1-234 amino acid of spike (S) proteins between the reference strains and twenty PEDV field strains in Jeonbuk. The dashes (−) indicate the deleted sequences. Insertions and deletions within PEDV isolates are indicated by boxes (Red box indicate the inserted amino acids compared with SM-98 and CV777. Blue box indicates the deleted amino acids compared with SM-98 or CV777).

Phylogenetic tree 분석

PEDV S 유전자의 염기서열을 이용하여 국내외 분리주와 phylogenetic tree를 분석한 결과, 본 연구에서 분리된 20개 바이러스주 모두 Genogroup 2b (G2b) 계열에 속하였다. PEDV는 S gene의 계통학적 분류를 통해 2가지 유전형(G1, G2)으로 나뉘고 각각 2개 그룹은 G1a, G1b, G2a, G2b의 보조그룹으로 나뉜다. G2b 그룹은 국내 분리주(KNU-1708/2017, KNU-1909/2019, KNU-1406-1/2014 등)와 미국 분리주(13-019349/2013, IA1/2013, IA2/2013 등) 및 중국 분리주(AH2012/2012, BJ-2011-1/2011, GD-B/2012, GD-1/ 2011 등) 등 최근에 유행하는 주가 속하였다. 국내에서 분리된 QIAP1401주 또한 G2b형으로 확인되었다. 국내 백신주로 많이 사용되고 있는 SM-98-1과 DR-13주는 G1 계열로 현재 유행하고 있는 PEDV와는 계통 발생학적으로 차이가 있음을 확인하였다(Fig. 2).

Figure 2. Phylogenetic analysis based on the nucleotide sequence corresponding to the full-length S gene of PEDV strains. Sequencing alignments were performed using the Clustal W program, and the phylogenetic tree was constructed from the aligned nucleotide sequences by using the neighbor-joining method. The bootstrap values were determined from 1,000 replicates of original data. The scale bars indicate the number of 0.050 inferred substitutions per site. Putative similar regions of S gene of other distantly related coronavirus, transmissible gastroenteritis virus (TGEV), was also included in this study.

S 유전자의 항원성 분석

S 유전자의 항원성에 대한 변이를 조사하기 위해 neutralizing epitope으로 밝혀진 COE (503∼642 aa), SS2 (752∼759 aa), SS6 (768∼775 aa), 2C10 (1,372∼1,378 aa) 부위를 초기 백신주 SM-98-1주와 비교 분석하였다. COE domain에서, 분리된 18주 모두 변이된 부위는 10개(L→S at 507, A→S at 521, L→H at 525, S→G at 527, V→I at 531, T→S at 553, G→S at 598, A→E at 609, L→F at 616, I→V at 639)였으며, 국내 백신주 QIAP1041과 비교 결과 같은 변이부위가 확인되었다. 20개 중 2개의 분리주(JBBI20, JBSJ24)에서는 1개 부위(L→H at 525)에서 변이가 보이지 않았다. 2주(JBBI04, JBBI11)에서 1개(Y→I at 531)의 부위, 1주(JBSJ44)에서 1개(P→Y at 555) 부위에서 변이가 관찰되었다. SS6 region에서는 분리된 20주 모두 2개(P→S at 768, Y→S at 770) 부위에서 아미노산 변이가 관찰되었으며, SS2와 2C10에서는 어떠한 변이도 관찰되지 않았다(Fig. 3).

Figure 3. Comparison of the antigen epitopes between field strains and reference strains. Dots indicate the amino acids are identical to those of reference strain SM-98-1. COE is in the red box, SS2 is in the blue box, SS6 is in the green box and the against 2C10 is in the orange box. The mutated amino acids within PEDV isolates are indicated by boxes and circles. Black box indicates the mutated amino acids compared with SM-98-1.

고 찰

국가가축방역통합시스템에 의하면 PED는 2014년 전국적으로 114호 21,260두의 발생 보고 이후 2018년 221호 34,716두, 2022년 233호 21,086두가 발생하는 등 백신 실시에도 불구하고 좀처럼 발생이 감소하지 않고 있다. 자돈의 경우 설사 및 탈수로 인해 생후 1주 미만의 자돈은 폐사율이 높고, 모돈도 자돈 폐사로 인한 포유 중단으로 불규칙한 발정과 산자수 감소 등 번식성적 감소를 유발하며, 발생농가는 질병이 쉽게 근절되지 않아 정상적인 모돈의 번식 능력을 회복하는데 시간과 노력이 요구된다.

코로나바이러스의 구조 protein 중 바이러스의 외피의 바깥층에 위치하여 가장 먼저 숙주 세포와 접촉하고 숙주세포의 침입에 결정적 역할을 하는 spike (s) protein은 유전적 다양성을 결정하는 중요한 단백질이다. 혈청학적으로 PEDV는 단일 혈청형이지만, S gene의 계통학적 분류를 통해 2가지 유전형(G1, G2)으로 나눌 수 있다. G1은 기존 백신주 및 세포적응주 등의 고전형(classical strain) 바이러스들이 속해 있고, G2는 야외유행주(epidemic strain) 및 대유행주(pandemic strain)가 포함되어 있다. 각각의 그룹은 2개의 보조그룹으로 나뉘어 G1은 고전주 아형그룹인 G1a와 G1a/G2b의 재조합 형태인 G1b로, G2 그룹은 고병원성으로 2013년 대유행 이전 야외주 G2a 및 대유행주 유래 최근 야외주 G2b로 구성되어 있다(Lee 등, 2010). 세계적으로 G1b strain 및 G2b strain의 발생이 보고되고 있지만, G2b strain이 주로 유행하고 있고, 이는 국내에서도 마찬가지로 G2b strain의 PEDV가 유행하고 있다(Lee와 Lee, 2014; Kim 등, 2015).

본 연구에서 분리된 20주의 S 유전자 염기서열 및 아미노산 분석 결과, 최근 발생 보고된 국내 야외주들과 같이 G2b 그룹으로 분류되었으며, 분리주간 염기서열 상동성은 98.6∼100%, 아미노산 상동성은 97.4∼100%로 높은 상동성을 가진 것으로 나타났다. 특히, JBBG31, JBBG33, JBBG32, JBBG38, JBBG42, JBBG34, JBBI27, JBBK41주는 유전자 분석 결과 100%의 상동성을 보였는데, 같은 지역 및 인접한 지역임을 고려할 때 같은 바이러스의 유행하는 것으로 추정할 수 있고, Park 등(2021)이 보고한 결과와 같은 것으로 보아 전북지역 양돈 밀집사육 지역의 PEDV의 지속적인 감염을 추정할 수 있으며, 양돈 밀집 지역은 농가단위 방역보다 취약대상을 포함한 집중 방역조치가 필요한 것으로 생각된다.

국내에서는 2000년 초부터 국내분리주인 SM98-1과 DR-13주의 G1그룹을 이용한 약독화백신과 사독백신을 사용해 왔으나 2013년∼2014년부터 유행하는 타입은 G2b 그룹으로, 이는 미국 분리주와 유사성이 높은 것으로 보고 되었다(Lee와 Lee, 2014; Lee 등, 2015). 본 연구에서 분리된 20주의 계통분석 결과 G2b의 그룹으로 확인되어, G1그룹인 SM-98주 및 DR-13주와는 다른 그룹을 형성하고 있었으며 염기서열 및 아미노산 서열 비교 결과, 염기서열에서는 각각 6.8∼7.9%, 6.4∼7.5%, 아미노산에서는 각각 7.7∼10.3%, 6.9∼9.4%의 차이를 보였다. 반면에 국내 백신주인 QIAP1401주와의 비교에서는 같은 G2b그룹으로 0.7∼1.8%, 아미노산 서열은 0.6∼2.9%의 차이로 나타나 높은 일치율을 보였다. PEDV S protein은 1,383에서 1,386의 아미노산으로 구성되어 있고, 바이러스와 숙주 세포 사이의 수용체 결합영역(receptor-binding domain)을 가지고 있는 S1 subunit (1∼789 aa)과 바이러스 외피에 spike를 고정하고 단백질 분해효소(protease) 활성화 시 융합을 가능하게 줄기를 형성하는 S2 subunit (790∼1,383 aa) 두부분으로 나뉠 수 있다(Sun 등, 2007; Deng 등, 2016). S1 subunit에 포함된 아미노산의 변형이 가장 많은 N-terminal region이 PEDV의 항원성에 결정적인 역할을 하며 PEDV 분리주들 사이의 유전적 연관성과 특성을 판단하고, 유효한 백신 개발에 활용하기 적합한 바이러스 유전자로 알려져 있다(Lee 등, 2010; Oh 등, 2014).

본 연구에서 분리된 20주와 초기 백신주인 CV777, SM-98-1주의 N-terminal region을 비교한 결과 56∼59번 위치에서 4개의 아미노산 삽입, 140번 위치에서 1개의 아미노산 삽입, 160∼161번 위치에서 2개의 결손이 존재하여 Lee 등(2010)이 보고한 G2그룹의 유전적 특징과 같은 결과를 얻을 수 있었다. 또한, 중화항체 생성에 관여하는 것으로 알려진 neutralizing epitope (COE, SS2, SS6, 2C10) 부위를 초기 국내 백신주 SM-98-1과 비교 결과, COE 부위에서는 18개의 분리주에서 모두 변이가 관찰된 10개 부위를 포함해 11개 부위에서 변이가 보였고, 2개의 분리주에서는 9개의 변이가 관찰되었다. SS6에서는 20개 분리주가 2개 부위에서 모두 변이 되었으나, SS2와 SS10에서는 변이가 관찰되지 않았다(Sun 등, 2012; Park 등, 2016). 이러한 S 유전자에서의 변이는 PEDV 균주의 유전적 진화와 병원성을 밝히는데 중요하고 특히 S1 subunit의 COE 및 SS6 부위는 야외 PEDV의 다양성을 나타내며 염기서열의 삽입, 결손 및 항원 부위의 변이는 바이러스의 항원성 및 중화 작용에 변화를 유발할 수 있기에, PEDV 변이주의 출현 계기가 될 수 있다(Lin 등, 2016).

농림축산검역본부에서는 매년 전국의 모돈의 혈청에서 최근 유행하는 PEDV G2b 타입에 대한 항체가 조사를 실시하고 있다. 이는 PEDV에 치명적인 자돈에서 모체항체가 태반을 통과하지 못하기 때문에 초유를 통해 자돈의 방어효과를 확인하기 위한 것으로 모돈의 방어항체가 64배 이상이 되어야 자돈에서 방어가 가능하다(Langel 등, 2016). 초유의 면역을 증강시키기 위해 국내에서는 2000년대 초 PED 백신 출시 이후 분만전 2∼3주 간격으로 임신 모돈에 생독-사독-사독의 접종 프로그램이 권장되어 왔다. 특히, PED 음성 돈군 또는 상재화 돈군의 경우, 사독백신 만으로는 중화항체 형성 및 방어 효과가 부족하기 때문에 생독-사독-사독 백신 프로그램의 지속 적용이 추천되고 있다. 2013년 말부터 현재까지 유행하는 G2b 타입의 PEDV를 분리하여 PED 불활화백신과 생백신이 개발되어 사용하고 있고 최근에는 경구접종 및 근육접종 모두 가능한 생백신이 출시되어 양돈농가에서 사용되고 있으나, 인공감염을 선호하거나 기존 1세대 G1a 백신을 접종하는 농가도 있는 실정이다. 인공감염으로 사용되는 바이러스는 병원성이 높은 G2b 타입의 바이러스로 농장 전체에 병원성이 높은 바이러스가 오염되어 지속적으로 질병을 유발할 수 있고, 기존 G1a 그룹 생독 백신(SM-98-1 및 DR-13주)의 사용은 숙주 내에서 충분치 못한 면역 유도로 야외에서 순환하고 있는 G2b 바이러스의 변이와 재조합 등을 유발할 수 있다(Lee, 2015; Lin 등, 2016). 따라서, 국내 발생 중인 PED의 효과적인 예방을 위해서는 현재 유행하는 타입에 맞는 G2b타입의 백신을 사용해야 하고 농장간 철저한 차단방역을 실시해야 한다. 또한 유전자 염기서열 분석을 통해 유행하는 PEDV의 유전적 변이에 대한 지속적인 모니터링이 필요할 것으로 사료된다.

결 론

2022년 전북지역에서 PED로 확인된 20개의 시료를 대상으로 PEDV S 유전자를 증폭하여 유전적 특성을 비교 분석하였다. 분리한 20개의 PEDV S 유전자 전체 염기서열 분석 결과, G2b 타입으로 분류되었고, 분리주간 염기서열은 98.6∼100.0%, 아미노산은 97.4∼100.0%의 높은 유전적 상동성을 보였다. 국내의 상용 백신주(SM-98-1, DR-13, QIAP1401)와 염기서열 및 아미노산 상동성을 비교한 결과, QIAP1401주와는 98.2∼99.3% (97.1∼99.4%)로 높은 상동성을 보였으나 SM-98-1 및 DR-13주와는 92.1∼93.6% (89.7∼93.1%)의 낮은 일치율을 보였다. 20주의 전북 PEDV 분리주와 백신주의 중화항체 유도부위(COE, SS2, SS6, 2C10)에 대한 비교 결과, 분리주에 따라 SM-98-1주 대비 10∼14개의 아미노산 변이가 확인되었다. PEDV S protein의 아미노산 변이는 변이주의 출현에 기회를 제공할 수 있으므로 지속적인 모니터링이 필요하며, 유행하는 PEDV의 유전형에 따른 새로운 백신도 계속해서 개발되어져야 할 것이다.

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

Fig 1.

Figure 1.Alignment of amino N-terminal 1-234 amino acid of spike (S) proteins between the reference strains and twenty PEDV field strains in Jeonbuk. The dashes (−) indicate the deleted sequences. Insertions and deletions within PEDV isolates are indicated by boxes (Red box indicate the inserted amino acids compared with SM-98 and CV777. Blue box indicates the deleted amino acids compared with SM-98 or CV777).
Korean Journal of Veterinary Service 2024; 47: 9-17https://doi.org/10.7853/kjvs.2024.47.1.9

Fig 2.

Figure 2.Phylogenetic analysis based on the nucleotide sequence corresponding to the full-length S gene of PEDV strains. Sequencing alignments were performed using the Clustal W program, and the phylogenetic tree was constructed from the aligned nucleotide sequences by using the neighbor-joining method. The bootstrap values were determined from 1,000 replicates of original data. The scale bars indicate the number of 0.050 inferred substitutions per site. Putative similar regions of S gene of other distantly related coronavirus, transmissible gastroenteritis virus (TGEV), was also included in this study.
Korean Journal of Veterinary Service 2024; 47: 9-17https://doi.org/10.7853/kjvs.2024.47.1.9

Fig 3.

Figure 3.Comparison of the antigen epitopes between field strains and reference strains. Dots indicate the amino acids are identical to those of reference strain SM-98-1. COE is in the red box, SS2 is in the blue box, SS6 is in the green box and the against 2C10 is in the orange box. The mutated amino acids within PEDV isolates are indicated by boxes and circles. Black box indicates the mutated amino acids compared with SM-98-1.
Korean Journal of Veterinary Service 2024; 47: 9-17https://doi.org/10.7853/kjvs.2024.47.1.9

Table 1 . List of primers utilized in this study.

PrimerNucleotide sequence, 5’→3’Length (bp)PositionAccession number
PEDVS1-FCCATTAGTGATGTTGTGTTAG1,03120,535JN599150
PEDVS1-RGCACAGCAGCTCCATT21,565
PEDVS2-FCCACATACCAGAAGGTTTTAG1,14621,372JN599150
PEDVS2-RCCAGTAATCAACTCACCCTT22,517
PEDVS3-FCCCTGAGTTTGGTAGTGG1,13422,466JN599150
PEDVS3-RCATCCGTCTGTAGAGCAAG23,599
PEDVS3-F2TGGTCATAGTGGTGCCAACC1,41922,163JN599150
PEDVS3-R2TTGCGCTGTAGAACATCCGT23,581
PEDVS4-FCTCATCGGTGGTATGGTGCT1,35523,497JN599150
PEDVS4-RAGCAGACTTTGAGACATCTTTGAC24,851
PEDVS5-FACTCTGGTGTCATGGTAC1,49023,433JN599150
PEDVS5-RATTGCGCCTCAAAGAAGACG24,922

Table 2 . The recent porcine epidemic diarrhea virus (PEDV) analyzed in this study.

StrainAreaBreeding scale (pigs)Damage situation (pigs)Country and yearGenBank accession number
JBBI03Iksan3,000110Korea, 2022PP146383
JBBI04Iksan3,300108Korea, 2022PP146384
JBBI05Iksan2,70088Korea, 2022PP146385
JBBG31Gunsan2,10040Korea, 2022PP146386
JBBG33Gunsan1,70030Korea, 2022PP146387
JBBG32Gunsan2,300100Korea, 2022PP146388
JBBG38Gunsan1,50080Korea, 2022PP146389
JBBG42Gunsan1,600109Korea, 2022PP146390
JBBG34Gunsan2,000300Korea, 2022PP146391
JBBI11Iksan65027Korea, 2022PP146392
JBBI20Iksan75066Korea, 2022PP146393
JBBI27Iksan3,500449Korea, 2022PP146394
JBBK41Kimje5,700120Korea, 2022PP146395
JBSJ10Jeongeup2,200350Korea, 2022PP146396
JBSJ24Jeongeup10,200359Korea, 2022PP146397
JBSJ44Jeongeup3,700133Korea, 2022PP146398
JBSK22Gochang2,200300Korea, 2022PP146399
JBSK07Gochang2,400650Korea, 2022PP146400
JBSJ06Jeongeup1,800862Korea, 2022PP146401
JBSJ08Jeongeup1,700400Korea, 2022PP146402

Table 3 . The reference porcine epidemic diarrhea virus (PEDV) strains analyzed in this study.

StrainCountry and yearGenBank accession number
CV777Belgium, 1978AF353511
CH SChina, 1986JN547228
SM98Korea, 1998GU937797
Virulent DR13Korea, 1999JQ023161
Attenuated DR13Korea, 2003JQ023162
TGEVUSA, 2006DQ811788
LZCChina, 2006EF185992
JS2008China, 2008KC210146
KNU-0802Korea, 2008GU180143
KNU-0801Korea, 2008GU180142
KNU-0901Korea, 2009GU180144
AJ1102China, 2011JX188454
CHGD-01China, 2011JX261936
ZJCZ4China, 2011JX524137
BJ-2011-1China, 2011JN825712
CH ZMDZY 11China, 2011KC196276
CH FJND-3China, 2011JQ282909
GD-AChina, 2012JX112709
LCChina, 2012JX489155
AH2012China, 2012KC210145
JS-HZ2012China, 2012KC210147
GD-BChina, 2012JX088695
SD-MChina, 2012JX560761
GD-1China, 2012JX647847
Attenuated vaccineChina, 2013KC189944
IA1USA, 2013KF468753
IA2USA, 2013KF468754
13-019349USA, 2013KF267450
Iowa106USA, 2013KJ645695
OH851USA, 2014KJ399978
QIAP1401*Korea, 2014KX793713
KNU 1409-1Korea, 2013KJ741221
KNU-1701Korea, 2017MH052680
KNU-1708Korea, 2017MH052687
KNU-1710Korea, 2017MH052689
KNU-1806Korea, 2018MH243318
KNU-1904Korea, 2019MN971595
KNU-1909Korea, 2019MN844888

*Korean PEDV vaccine strains..


Table 4 . Comparison of the nucleotide and deduced amino acid sequences of S genes of PEDV references strains and PEDV isolates in Jeonbuk.

Virus strain123456789101112131415161718192021222324252627
1. SM98/Korea/199898.892.394.092.394.996.789.792.192.192.292.292.292.292.292.292.192.392.292.292.292.392.092.292.292.192.2
2. CV777/belgium/197896.393.595.293.596.198.090.993.393.393.493.493.493.493.493.493.393.593.493.493.493.593.293.493.493.393.4
3. QIAP1401/Korea/201493.393.895.999.993.294.597.199.199.199.399.399.399.399.399.399.199.199.399.399.499.299.199.499.399.399.4
4. KNU-1409-1/Korea/201394.495.196.795.995.396.793.495.695.695.895.895.895.895.895.895.695.695.895.895.895.795.695.895.895.795.8
5. IA2/USA/201393.393.899.896.693.194.597.199.199.199.399.399.399.399.399.399.199.199.399.399.499.299.199.499.399.399.4
6. attenuated DR13/Korea/201396.399.993.895.293.998.290.692.992.993.193.193.193.193.193.192.993.093.193.193.193.092.993.193.192.993.1
7. virulent DR13/Korea/199997.998.394.996.395.098.491.994.394.394.494.494.494.494.494.494.394.394.494.494.494.394.294.494.494.394.4
8. JBBI0392.192.598.395.498.292.593.797.497.497.597.597.597.597.597.597.497.397.597.597.797.497.397.797.597.697.7
9. JBBI0493.093.499.396.499.293.594.698.699.799.999.999.999.999.999.9100.099.699.999.999.799.899.599.799.999.699.7
10. JBBI0593.093.599.296.399.293.694.798.699.899.999.999.999.999.999.999.799.699.999.999.799.899.599.799.999.699.7
11. JBBG3193.193.599.396.499.393.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
12. JBBG3393.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
13. JBBG3293.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
14. JBBG3893.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
15. JBBG4293.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
16. JBBG3493.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.099.999.8100.0100.099.999.999.699.9100.099.799.9
17. JBBI1193.093.499.396.499.293.594.698.6100.099.899.999.999.999.999.999.999.699.999.999.799.899.599.799.999.699.7
18. JBBI2093.193.499.296.499.293.594.698.699.899.899.999.899.899.899.899.899.899.899.899.699.999.499.699.899.599.6
19. JBBI2793.193.599.396.499.393.694.798.699.999.9100.0100.0100.0100.0100.0100.099.999.9100.099.999.999.699.9100.099.799.9
20. JBBK4193.093.599.396.499.293.694.798.699.999.9100.0100.0100.0100.0100.0100.099.999.8100.099.999.999.699.9100.099.799.9
21. JBSJ1093.293.699.396.599.393.694.899.099.699.699.799.699.699.699.699.699.699.699.799.699.899.6100.099.999.9100.0
22. JBSJ2493.193.599.396.499.393.694.798.699.999.9100.099.999.999.999.999.999.999.9100.099.999.799.699.899.999.699.8
23. JBSJ4493.093.499.296.499.193.594.798.899.599.599.599.599.599.599.599.599.599.599.599.599.899.599.699.699.599.6
24. JBSK2293.293.699.396.599.393.694.899.099.699.699.799.699.699.699.699.699.699.699.799.6100.099.799.899.999.9100.0
25. JBSK0793.193.599.396.499.393.694.798.699.999.9100.099.999.999.999.999.999.999.9100.099.999.799.999.599.799.799.9
26. JBSJ0693.193.599.396.599.293.694.798.999.699.599.699.699.699.699.699.699.699.599.699.699.999.699.799.999.699.9
27. JBSJ0893.293.699.396.599.393.694.899.099.699.699.799.699.699.699.699.699.699.699.799.6100.099.799.8100.099.799.9

The percent identify was shown in the lower left (nucleotide) and the upper right (deduced amino acid)..


References

  1. Chang SH, Bae JL, Kang TJ, Kim J, Chung GH, Lim CW, Laude H, Jang YS. 2002. Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus. Mol Cells 14:295-299.
    Pubmed CrossRef
  2. Debouck P and Pensaert M. 1980. Experimental infection of pigs with a new porcine enteric coronavirus, CV 777. Am J Vet Res 41:219-223.
  3. Duarte M, Gelfi J, Lambert P, Laude H. 1993. Genome organization of porcine epidemic diarrhoea virus. Adv Exp Med Biol 342:55-60.
    Pubmed CrossRef
  4. Kim SH, Lee JM, Jung J, Kim IJ, Hyun BH, Kim HI, Park CK, Oem JK, Kim YH, Lee KK. 2015. Genetic characterization of porcine epidemic diarrhea virus in Korea from 1998 to 2013. Arch Virol 160:1055-1064.
    Pubmed KoreaMed CrossRef
  5. Kweon CH, Kwon BJ, Jung TS, Kee YJ, Hur DH, Hwang EK, An SH. 1993. Isolation of porcine epidemic diarrhea virus (PEDV) in Korea. Korean J Vet Res 33:249-254.
  6. Langel SN, Paim FC, Lager KM, Saif LJ. 2016. Lactogenic immunity and vaccines for porcine epidemic diarrhea virus (PEDV): Historical and current concepts. Virus Res 226:93-107.
    Pubmed KoreaMed CrossRef
  7. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Higgins DG. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2947-2948.
    Pubmed CrossRef
  8. Lee CH. 2015. Porcine epidemic diarrhea virus: An emerging and re-emerging epizootic swine virus. Virol J 12:193.
    Pubmed KoreaMed CrossRef
  9. Lee DK, Park CK, Lee C. 2010. Heterogeneity in spike protein genes of porcine epidemic diarrhea viruses isolated in Korea. Virus Res 149:175-182.
    Pubmed KoreaMed CrossRef
  10. Lee SH and Lee CH. 2014. Outbreak-related porcine epidemic diarrhea virus strains similar to US strains, South Korea, 2013. Emerg Infect Dis 20:1223-1226.
    Pubmed KoreaMed CrossRef
  11. Lin CM, Saif LJ, Wang Q. 2016. Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains. Virus Res 226:20-39.
    Pubmed KoreaMed CrossRef
  12. Madson DM, Magstadt DR, Arruda PH, Hoang H, Sun D, Bower LP, Bhandari M, Burrough ER, Pillatzki AE, et al. 2014. Pathogenesis of porcine epidemic diarrhea virus isolate (US/Iowa/18984/2013) in 3-week-old weaned pigs. Vet Microbiol 174:60-68.
    Pubmed CrossRef
  13. Oh J, Lee KW, Lee CJ. 2014. Immunogenicity and protective efficacy of recombinant S1 domain of the porcine epidemic diarrhea virus spike protein. Arch Virol 159:2977-2987.
    Pubmed KoreaMed CrossRef
  14. Park HS, Yook SY, Jeon DM, Shin CH. 2016. Genetic sequence and phylogenetic analysis of spike genes of porcine epidemic diarrhea virus (PEDV) in Chung-Nam area. Korean J Vet Serv 39:259-266.
    CrossRef
  15. Park MY, Moon BM, Gang SJ, Lee JH, Park JW, Her CH. 2021. Genetic sequence and phylogenetic analysis of spike genes of porcine epidemic diarrhea virus (PEDV) in Jeonbuk province. Korean J Vet Serv 44:73-83.
  16. Pijpers A, van Nieuwstadt AP, Verheijden JH. 1993. Porcine epidemic diarrhoea virus as a cause of persistent diarrhoea in a herd of breeding and finishing pigs. Vet Rec 132:129-131.
    Pubmed CrossRef
  17. Sun RQ, Cai RJ, Chen YQ, Liang PS, Song CX. 2012. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerg Infect Dis 18:161-163.
    Pubmed KoreaMed CrossRef
  18. Tamura K, Kumar S. 2021. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022-3027.
    Pubmed KoreaMed CrossRef
  19. Tran TX, Lien NTK, Thu HT, Duy ND, Quyen DV. 2021. Changes in the spike and nucleocapsid protein of porcine epidemic diarrhea virus strain in Vietnam-a molecular potential for the vaccine development? PeerJ 9:e12329.
    Pubmed KoreaMed CrossRef
KJVS
Mar 30, 2024 Vol.47 No.1, pp. 1~7

Stats or Metrics

Share this article on

  • line

Related articles in KJVS

Korean Journal of
Veterinary Service

eISSN 2287-7630
pISSN 1225-6552
qr-code Download