Korean Journal of
Veterinary Service

Circoviruses are small non-enveloped DNA viruses containing a single circular, covalently closed, and single-stranded genome, which belongs to the genus Circovirus of the family Circoviridae (Rosario et al, 2017). To date, four species of circoviruses that infect pigs have been identified: porcine circovirus (PCV) type 1 (PCV1), type 2 (PCV2), type 3 (PCV3), and type 4 (PCV4). PCV1 was first recognized as a contaminant of the continuous porcine kidney cell line PK-15 (ATCC-CCL31) and subsequently determined to be nonpathogenic to pigs (Tischer et al, 1982). In contrast, PCV2, identified in diseased pigs in the early 1990s, is now considered a major disease-causing pathogen leading to an immense economic loss in the global swine industry (Opriessnig et al, 2007; Segalés, 2012). The clinical manifestations of PCV2 infections are collectively termed PCV-associated disease (PCVAD), characterized by several clinical conditions, including post-weaning multisystemic wasting syndrome (PMWS), porcine dermatitis, and nephropathy syndrome (PDNS), reproductive disorders, enteritis, proliferative and necrotizing pneumonia, and porcine respiratory disease complex (PRDC). In 2015, a third PCV species, PCV3, was discovered, in the USA, in pigs with PDNS, reproductive failure, myocarditis, and multisystemic inflammation (Phan et al, 2016; Palinski et al, 2017). Since then, PCV3 has been globally identified in pigs with various clinical symptoms consistent with those of PCVAD in several countries, including South America (Tochetto et al, 2018; Saraiva et al, 2019), Europe (Stadejek et al, 2017; Fux et al, 2018; Klaumann et al, 2019), and Asia, particularly China (Ku et al, 2017), and Korea (Kim et al, 2017; Kwon et al, 2017; Park et al, 2018; Kim et al, 2020). More recently, in 2019, a fourth novel and genetically distinct PCV, designated PCV4, was discovered in pigs with PDNS-like clinical syndrome in Hunan province, China (Zhang et al, 2020b). PCV4 infection was further confirmed in diseased and healthy pigs in other provinces in China (Zhang et al, 2020a; Sun et al, 2021; Tian et al, 2021) and Korea (Nguyen et al, 2021; Kim et al, 2022a; Kim et al, 2022b). Since PCV4 is difficult to isolate in vitro using cell culture (Zhang et al, 2020b), molecular diagnostic assays, such as conventional and real-time PCR, are currently used to detect PCV4 in clinical samples. Conventional PCR and quantitative real-time PCR (qPCR) are used for the routine diagnosis of PCV4 because of their high specificity, sensitivity, and ability to detect and differentiate multiple targets simultaneously (Zhang et al, 2020a; Chen et al, 2021; Hou et al, 2021; Tian et al, 2021; Chen et al, 2022; Kim et al, 2022b). The clinical manifestations of PCV3 and PCV4 are similar to those of PCV2, and co-infection with PCV2, PCV3, and PCV4 has been confirmed in pig populations. Therefore, a rapid and reliable diagnostic assay is required for the differential detection of PCV2, PCV3, and PCV4 in the field (Kim et al, 2017; Zhang et al, 2020a; Chen et al, 2021; Sun et al, 2021; Kim et al, 2022b). Several multiplex qPCR (mqPCR) assays have been developed for the simultaneous detection of different types of PCVs, such as duplex qPCR for PCV2 and PCV3 (Kim et al, 2017; Li et al, 2018; Wang et al, 2019); PCV3 and PCV4 (Hou et al, 2021); triplex qPCR for PCV1, PCV2, and PCV3 (Yang et al, 2019); and quadruplex qPCR for PCV1, PCV2, PCV3, and PCV4 (Chen et al, 2021). However, considering the pathogenicity and clinical significance of PCV2, PCV3, and PCV4 in pigs, a new mqPCR method is necessary for differential detection of these three pathogenic PCVs in clinical pig samples. Therefore, in this study, we developed a new triplex qPCR (tqPCR) assay capable of detecting and typing PCV2, PCV3, and PCV4 and evaluated its diagnostic potential using pig samples to investigate the prevalence and co-infection status of the three pathogenic PCVs in Korean pig farms.

Viruses and samples

PCV2 (PCK0201 strain) (Park et al, 2004), PCV3 (PCK3- 1701 strain) (Kim et al, 2017), and PCV4 (PCV4-K2101 strain) (Kim et al, 2022a) Korean field strains were used to optimize tqPCR conditions. Other porcine viral pathogens, including PCV1 (from infected PK-15 cell culture), type 1 porcine reproductive and respiratory syndrome virus (PRRSV, Lelystad virus), type 2 PRRSV (LMY strain), classical swine fever virus (CSFV, LOM strain), and porcine parvovirus (PPV, NADL-2 strain) were obtained from the Animal and Plant Quarantine Agency and Animal Disease Intervention Center for evaluating specificity. All pathogen samples were stored at −80℃ until use. For clinical evaluation of the tqPCR assay and investigation of prevalence and co-infection status of PCVs, 1476 clinical samples (tissue, serum, or oral fluid) were collected from 198 domestic pig farms that had experienced outbreaks of respiratory and systemic diseases during 2019 and 2020. The tissue samples were homogenized and diluted 10-fold with phosphate-buffered saline (0.1 M, pH 7.4). All samples were frozen and thawed twice, vortexed for 5 min, and centrifuged at 10,000×g (Hanil, Republic of Korea) for 10 min at 4℃. Viral DNA and RNA were extracted from 200 μL of virus stocks and field samples using a TANBead nucleic acid extraction kit with a fully automated magnetic bead operating platform (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan) and eluted into 100 μL of elution buffer, according to the manufacturer’s instructions. For RNA viruses, total RNA was reverse transcribed to cDNA using the Primescript™ 1st strand cDNA synthesis kit (Takara Korea Biomedical Inc., Seoul, Republic of Korea), according to the manufacturer’s instructions. All nucleic acid samples were stored at −80℃.

Construction of DNA standards

Plasmids containing the complete capsid genes of the PCV2 PCK0201 and PCV3 PCK3-1701 strains (GenBank accession numbers MF964236 and MF611876, respectively) were used as DNA standards for PCV2 and PCV3, respectively, as previously reported (Kim et al, 2017). For PCV4, the complete capsid gene was amplified by PCR from a Korean PCV4 strain (PCV4-K2101, GenBank accession number MZ436811) using specific primers (PCV4-1038F 5′-CACTACGCATTATCCCTGTTTG-3′ and PCV4-1741R 5′-ACCCACAGATGCCAATCAGA-3′). PCR was carried out using a commercial kit (PrimeSTAR® GXL DNA Polymerase; Takara, Shiga, Japan) in 50 μL reaction mixtures containing 10 μL of 5X PrimeSTAR GXL buffer, 4 μL of dNTP mixture, 1 μL of PrimeSTAR GXL DNA polymerase, 0.2 μM of each primer, and 5 μL of PCV4 DNA as a template, according to the manufacturer’s instructions. Amplification was carried out using a thermal cycler (Applied Biosystems, USA) under the following conditions: initial denaturation at 98℃ for 1 min, 35 cycles of amplification (10 s at 98℃, 15 s at 55℃, and 2 min at 68℃), and a final extension at 68℃ for 7 min. The amplified product was purified and cloned into pTOP TA V2 vector (TOPcloner™ TA core Kit; Enzynomics, Korea) and transformed into Escherichia coli competent cells according to the manufacturer’s instructions (DH5α chemically competent E. coli; Enzynomics, Republic of Korea). Each plasmid containing the PCV2, PCV3, and PCV4 capsid genes was purified using a commercial kit (GeneAll Expin Combo GP 200 miniprep kit, GeneAll, Seoul, Republic of Korea). DNA concentration of each plasmid was determined by measuring the absorbance at 260 nm using a NanoDrop Lite instrument (Thermo Scientific, Waltham, MA, USA), and the copy number of each cloned gene was quantified as previously described (Kim et al, 2017). PCV2, PCV3, and PCV4 standard DNA samples were serially diluted by 10-fold (from 10⁶ to 10⁰ copies/μL), stored at −80℃, and used as standards for viral DNA quantitation of diagnostic samples.

Primers and probes for tqPCR assay

Three sets of primers and probes were used for differential detection of PCV2, PCV3, and PCV4 to establish the tqPCR assay. The primers and probes specific for capsid genes of PCV2 and PCV3 were taken from previously well-established duplex qPCR assays for simultaneous detection of PCV2 and PCV3 (Kim et al, 2017). The PCV4-specific primers and probe were newly designed using Primer Express software (version 3.0) (Applied Biosystems) based on 49 PCV4 genome sequences, including 47 Chinese and two Korean strains, available at the National Center for Biotechnology Information. To facilitate the establishment of tqPCR, the primers and probe for PCV4 were carefully designed so that their melting temperatures were consistent with those of the previously reported primers and probes for PCV2 and PCV3. No hairpin, self-dimer, or heterodimer formation between the primers and probes for PCV2, PCV3, and PCV4 were confirmed using OligoAnalyzer software (IDT, Inc., Skokie, IL, USA). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to determine the specificity of the primers and probes. Each primer and probe for PCV2, PCV3, and PCV4 showed 100% homology with the corresponding virus sequences. Furthermore, we evaluated the specificity of the qPCR assay using each primer/probe set in silico using FastPCR software, version 5.4 (PrimerDigital Ltd., Finland) following the developer’s instructions (Kalendar et al, 2011). The predictive success rate of the tqPCR with each primer/probe set was 99.4% (1870/1882) for PCV2, 100% (111/111) for PCV3, and 100% (49/49) for PCV4, showing that each tqPCR assay with the selected primer/probe sets was highly specific and could be applied to amplify PCV2, PCV3, or PCV4 capsid genes. For accurate differential detection of PCV2, PCV3, and PCV4 by tqPCR, sequence-specific probes should be labeled with reporter dyes, the fluorescence spectra of which are distinct or show only minimal overlap (Navarro et al, 2015). In this study, for the simultaneous and differential detection of capsid genes of PCV2, PCV3, and PCV4 in a single reaction, probes were labeled differently at the 5′ and 3′ ends with 6-carboxyfluorescein (FAM) and black hole quencher (BHQ) 1 for PCV2, 6-carboxy-X-rhodamine (ROX) and BHQ 2 for PCV3, and cyanine 5 (Cy5) and BHQ 2 for PCV4, according to the manufacturer’s guidelines (BIONICS, Daejeon, Republic of Korea) (Table 1).

Table 1 . Primers and probes for the triplex quantitative real-time polymerase chain reaction assay in this study.

Virus	Primer/probe	Sequence (5′-3′)*	Position†	Tm (℃)	Amplicon (base pairs)	Reference
PCV2	PCV2F	CCAGGAGGGCGTTSTGACT	1534∼1552	61.3	99	Kim et al (2017)
	PCV2R	CGYTACCGYTGGAGAAGGAA	1613∼1632	58.3
	PCV2P	FAM-AATGGCATCTTCAACACCCGCCTCT-BHQ1	1587∼1611	68.0
PCV3	PCV3F	CGGTGGGGTCATATGTGTTG	1443∼1462	62.5	118	Kim et al (2017)
	PCV3R	CACAGCCGTTACTTCACC	1543∼1560	60
	PCV3P	ROX-CTTTGTCCTGGGTGAGCGCTGGTAG-BHQ2	1496∼1520	69.6
PCV4	PCV4F	TAGTGGCAGAAATTCGACTT	1425∼1444	59.5	100	In this study
	PCV4R	GGACTTTATCCCAAAAGGAC	1505∼1524	58.1
	PCV4P	Cy5-CCGGTAATATGCAAATGGGAGGCTG-BHQ2	1458∼1482	66.7

*Bold text in sequences of PCV2F and PCV2R primers represent a degenerative base: S, C, or G; Y, C, or T, respectively..

^†Genome position of primer- and probe-binding sites were derived from the complete genome sequence of PCV2 PCK0201 strain (MF964236), PCV3 PCK3-1701 strain (MF611876), and PCV4 AHG-2019 strain (MK986820)..

PCV, porcine circoviruses..

Optimization of tqPCR conditions

Before optimization of the tqPCR conditions, each monoplex qPCR assay using PCV2-, PCV3-, or PCV4-specific primers and probe set was carried out using a commercial qPCR kit (RealHelix™ qPCR kit Probe, NanoHelix, Daejeon, Korea) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA). To optimize the tqPCR conditions, the concentrations of three sets of each primer and probe were optimized, whereas the other reaction components were maintained at the same concentrations used in the monoplex reactions. The monoplex qPCR and tqPCR cycling programs were the same and comprised the steps 15 min at 95℃ for initial denaturation, followed by 40 cycles at 95℃ for 20 s and 60℃ for 40 s for amplification. Fluorescence signals from FAM, ROX, and Cy5 were detected at the end of each annealing step. To interpret the monoplex and tqPCR results, samples that produced a cycle threshold (Ct) of less than 40 were considered positive, whereas those with a higher Ct value (>40) were considered negative, according to previously described guidelines (Broeders et al, 2014).

Specificity and sensitivity of the tqPCR assay

To test specificity, the tqPCR assay was performed with total nucleic acids extracted from eight viral samples (PCV1, PCV2, PCV3, PCV4, type 1 and 2 PRRSV, CSFV, and PPV) and two non-infected cultured cells (ST and PK-15 cells) of porcine-origin as negative controls. The sensitivity of the tqPCR and its corresponding monoplex qPCR assays was determined in triplicate using serial dilutions (from 10⁶ to 10⁰ copies/μL) of each standard plasmid DNA containing the capsid genes of PCV2, PCV3, or PCV4 mentioned above. For data analysis, CFX96 Touch Real-Time PCR detection software (Bio-Rad) was used to create a standard curve with the threshold cycle (Ct) values of each 10-fold dilutions of the standard PCV plasmid DNA (from 10⁶ to 10⁰ copies/μL). The detection software calculated the correlation coefficient (R²) of the standard curve, standard deviations, and the copy numbers of PCV2, PCV3, and PCV4 DNAs of the samples, based on the standard curves.

Precision of the tqPCR assay

Repeatability (intra-assay precision) and reproducibility (inter-assay precision) of the tqPCR assay for PCV2, PCV3, and PCV4 were determined using three different concentrations of each viral DNA standard. The concentrations of the PCV2, PCV3, and PCV4 standard DNA were 10⁶, 10⁴, and 10² copies/μL (high, medium, and low), respectively. For intra-assay variability, each dilution was analyzed in triplicate on the same day, whereas for inter-assay variability, each dilution was analyzed in six independent experiments performed by two different operators on different days according to the MIQE guidelines (Bustin et al, 2009). The coefficient of variation for Ct values was determined based on intra- or inter-assay results.

Clinical application of the tqPCR assay for PCV detection

To evaluate the diagnostic performance of the tqPCR assay for differential detection of PCV2, PCV3, and PCV4, 1476 clinical samples collected from 198 Korean domestic pig farms were tested. The tqPCR results were compared with those of each monoplex qPCR assay for PCV2, PCV3, or PCV4 with clinical samples described above. Monoplex qPCR assays with each viral capsid gene-specific primers and probe set were performed using a commercial qPCR kit (RealHelix™ qPCR kit Probe, NanoHelix) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad) as previously described reaction conditions (Kim et al, 2017; Chen et al, 2022). The diagnostic concordance between tqPCR and each monoplex qPCR was determined using Cohen’s kappa statistics at a 95% confidence interval (CI) (Kwiecien et al, 2011). Given a calculated kappa coefficient value of 0.81∼1.0, the results from these assays were almost 100% concordant. Furthermore, the prevalence and co-infection status of PCV2, PCV3, and PCV4 in domestic Korean pig farms were analyzed using the tqPCR results of clinical samples.

Optimal conditions of the tqPCR assay

For simultaneous and differential detection of PCV2, PCV3, and PCV4 capsid genes in a single reaction tube, the primer and probe concentrations were optimized under the same qPCR conditions in a triplex format. The tqPCR using the optimized primer and probe concentrations (0.3 μM of each primer and 0.15 μM of each probe for PCV2 and PCV3, and 0.4 μM of each primer and 0.4 μM of the probe for PCV4) simultaneously detected the fluorescent signals of FAM, ROX, and Cy5 (Fig. 1). The standard curve for each monoplex qPCR or tqPCR revealed a linear relationship between the log copy number and Ct value; the correlation coefficient (R²) over the entire concentration range was determined to be >0.99 for each monoplex qPCR or tqPCR, demonstrating that the developed tqPCR assay is highly quantitative (Fig. 2). Therefore, the newly developed tqPCR assay can quantitatively amplify the three target genes of PCV2, PCV3, and PCV4 in a single reaction without spurious amplification or significant crosstalk between the three fluorescent reporter dyes (Fig. 1, 2).

Figure 1. Sensitivities of monoplex and triplex real-time PCR (qPCR) assays for PCV2, PCV3, and PCV4. (A∼C) Monoplex qPCR assays for PCV2, PCV3, and PCV4; (D) triplex qPCR assay for PCV2, PCV3, and PCV4. Each monoplex and triplex qPCR assay was performed using 10-fold serial dilutions of viral DNA (10⁶ to 10⁰ copies/μL, lines 1∼7). NC, negative control.

Figure 2. Standard curves were generated from monoplex and triplex real-time PCR (qPCR) assays using PCV2, PCV3, and PCV4 DNA standards. (A∼C) Monoplex qPCR for PCV2, PCV3, and PCV4, respectively; (D) triplex qPCR for simultaneous detection of PCV2, PCV3, and PCV4. The monoplex and triplex qPCR assays were performed using 10-fold serial dilutions of each viral DNA standard in triplicate. Serial 10-fold dilutions of viral DNA standard (10⁶ to 10⁰ copies/μL) were plotted against the threshold cycle (Ct). The correlation coefficient value (R²) and the equation of the regression curve (y) were calculated using CFX Maestro software (Bio-Rad).

Specificity and sensitivity of the tqPCR assay

Each set of primers and probes for PCV2, PCV3, and PCV4 specifically amplified the target DNA of the respective virus only. No positive results were obtained for any of the other swine pathogens or the two swine-origin cell cultures (Fig. 3A∼3C). As expected, the capsid genes of PCV2, PCV3, and PCV4 were co-amplified using tqPCR from a mixed sample of PCV2, PCV3, and PCV4 DNA (Fig. 3D). These results indicate that the tqPCR assay can be applied for differential detection of PCV2, PCV3, and PCV4 in a single reaction tube (Fig. 1D). The limit of detection for the tqPCR assay was below 10 copies/µL of the capsid gene for PCV2, PCV3, and PCV4, which was consistent with that of each monoplex qPCR (Fig. 1).

Figure 3. Specificity of monoplex and triplex real-time PCR (qPCR) assays using PCV2, PCV3, and PCV4-specific primers and probe set. (A∼C) Amplification curve of monoplex qPCR for PCV2, PCV3, and PCV4, respectively; (D) amplification curves of triplex qPCR for PCV2, PCV3, and PCV4.

Precision of the tqPCR assay

The coefficients of variation within runs (intra-assay variability) were 0.02% to 0.60% for PCV2, 0.07% to 0.20% for PCV3, and 0.14% to 0.72% for PCV4. The inter-assay variabilities were 0.83% to 1.39% for PCV2, 1.09% to 1.92% for PCV3, and 0.93% to 2.07% for PCV4 (Table 2). Therefore, the assay showed high repeatability and reproducibility, with coefficients of intra-assay and inter-assay variation of less than 3%.

Table 2 . Intra- and inter-assay coefficient of variation of the triplex real-time polymerase chain reaction for PCV2, PCV3 and PCV4.

Dilution (copies/µL)	Coefficient of variation (%) for PCVs
	PCV2			PCV3			PCV4
	Intra-assay	Inter-assay		Intra-assay	Inter-assay		Intra-assay	Inter-assay
High (106)	0.47	0.83		0.20	1.09		0.72	1.59
Medium (104)	0.02	1.09		0.12	1.27		0.14	0.93
Low (102)	0.60	1.39		0.07	1.92		0.39	2.07

PCV, porcine circoviruses..

Clinical evaluation of tqPCR assay

For clinical evaluation of the newly developed tqPCR assay and investigation of prevalence and co-infection status of PCVs in Korean pig farms, 1476 clinical samples collected from 198 pig farms were tested using the tqPCR and each monoplex qPCR assays. The results were in 100% agreement with those of previously reported monoplex qPCR assays for PCV2, PCV3, and PCV4 (Kim et al, 2017; Chen et al, 2022), regardless of the tested sample type, with a κ value (95% CI) of 1 (1.00∼1.00), indicating that the diagnostic monoplex qPCR results were 100% concordant with the tqPCR assay (Table 3). These results demonstrate that the newly developed tqPCR assay can be applied for simultaneous and differential diagnosis of PCV2, PCV3, and PCV4 in field samples. The individual pig-level prevalence of PCV2, PCV3, and PCV4 in 1476 clinical samples tested was 13.8% (203/1476), 25.4% (375/1476), and 3.8% (56/1476), respectively (Fig. 4A). The co-infection analysis of clinical samples indicated that the single infection rates for PCV2, PCV3, and PCV4 were 8.7% (129/1476), 20.2% (298/1476), and 2.3% (34/1476), respectively. The dual infection rates for PCV2 and PCV3, PCV2 and PCV4, and PCV3 and PCV4 were 4.3% (63/1476), 0.5% (8/1476), and 0.7% (11/1476), respectively. The triple infection rate for PCV2, PCV3, and PCV4 was 0.2% (3/1476) (Fig. 4A). The prevalence of PCV2, PCV3, and PCV4 at the pig farm level was 46.5% (92/198), 63.6% (126/198), and 19.7% (39/198), respectively (Fig. 4B). The farm-level single infection rates for PCV2, PCV3, and PCV4 were 28.8% (57/198), 44.4% (88/198), and 9.6% (19/198), respectively. As a result of analyzing the co-infection status of the pig farms, the dual infection rates of PCV2 and PCV3, PCV2 and PCV4, and PCV3 and PCV4 were 12.6% (25/198), 3.5% (7/198), and 5.1% (10/198), respectively. The farm-level triple infection rate for PCV2, PCV3, and PCV4 was 1.5% (3/198) (Fig. 4B). These results reveal that PCV4 is widely spread, and its co-infection with PCV2 and PCV3 is common in Korean pig herds.

Table 3 . Comparative evaluation of triplex real-time polymerase chain reaction (qPCR) assay for detection of PCV2, PCV3, and PCV4 from clinical pig samples collected in 2019 and 2020.

Samples	No. of tested samples	No. of positive by monoplex qPCR (%)†				No. of positive by triplex qPCR (%)
		PCV2	PCV3	PCV4		PCV2	PCV3	PCV4
Serum	1,276	142 (11.1)	252 (19.7)	46 (3.6)		142 (11.1)	252 (19.7)	46 (3.6)
Tissue	158	43 (27.2)	104 (65.8)	5 (3.2)		43 (27.2)	104 (65.8)	5 (3.2)
Saliva	42	18 (42.9)	19 (45.2)	5 (11.9)		18 (42.9)	19 (45.2)	5 (11.9)
Total	1,476	203 (13.8)	375 (25.4)	56 (3.8)		203 (13.8)	375 (25.4)	56 (3.8)

^†Monoplex qPCR assay for PCV2, PCV3 or PCV4 was performed with each viral capsid gene-specific primers and TaqMan probe set as previously described (Kim et al, 2017; Chen et al, 2022)..

PCV, porcine circoviruses..

Figure 4. Prevalence and co-infection status for PCV2, PCV3, and PCV4 determined using the triplex real-time PCR assay with 1476 clinical pig samples from 198 pig farms in 2019 and 2020. (A) Individual pig-level prevalence and co-infection status; (B) pig farm-level prevalence and co-infection status.

Four genetically distinct porcine circoviruses, namely PCV1, PCV2, PCV3, and PCV4, infect pigs. PCV1 is considered nonpathogenic, whereas PCV2, PCV3, and PCV4 are associated with various clinical symptoms in pigs. Furthermore, co-infection with these viruses is common in Chinese and Korean pig herds (Zhang et al, 2020a; Zhang et al, 2020b; Chen et al, 2021; Hou et al, 2021; Nguyen et al, 2021; Sun et al, 2021; Kim et al, 2022a; Kim et al, 2022b). A reliable triplex diagnostic assay capable of simultaneously detecting PCV2, PCV3, and PCV4 in clinical samples is urgently required for epidemiological and clinical studies and to establish control strategies for PCV2, PCV3, and PCV4 infections.

Recently, a TaqMan probe-based mqPCR assay was developed for differential detection of four PCV species (Chen et al, 2021). The assay was developed in quadruplex format to simultaneously detect PCV1, PCV2, PCV3, and PCV4 in a single reaction, and the PCV4-specific primers and probe targeted to the PCV4 ORF1∼ORF2 region were designed to use two available PCV4 sequences at that time. However, primer self-dimers were generated by inter-molecular interaction between the PCV4 reverse primers as 10 nucleotides at the 3’ end of the reverse primer sequence (5’-ACAGGGATAATGCGTAGTGATCACT-3’) were reversibly complementary to each other. In general, qPCR primer design, primers, and probes with a high possibility of self-complementarity, particularly close to the 3’ end, should be avoided because secondary structures such as hairpins and primer-dimers can be formed and interfere with PCR amplification steps. Moreover, since primer dimers generated by intra- or inter-molecular interaction between primers adversely affect PCR efficiency, primers should be carefully designed to avoid primer dimer formation (Rodríguez et al, 2015). Therefore, we decided to design new PCV4-specific primers and probe sets for the tqPCR assay to avoid the primer designing issues of the mqPCR assay, and to make the target genes of three PCVs the same capsid gene for the tqPCR in the present study.

To establish the tqPCR for simultaneous and differential detection of PCV2, PCV3, and PCV4 in a single reaction, a set of primers and probes that can specifically amplify the capsid gene of PCV4 was designed and combined with two sets of primers and probes for PCV2 and PCV3 capsid genes, as was previously reported (Kim et al, 2017) (Table 1). After optimization of the tqPCR conditions, the tqPCR assay with three sets of PCV2-, PCV3-, and PCV4-specific primers and probes simultaneously and differentially detected PCV2, PCV3, and PCV4 DNAs in a single reaction with high specificity and sensitivity comparable with that of the corresponding monoplex qPCR assays (Fig. 1∼3). The sensitivity of the developed tqPCR assay was <10 copies/μL for PCV2, PCV3, and PCV4, which was comparable to that of previously reported duplex PCR assay for PCV2 and PCV3 (Kim et al, 2017) and like those of SYBR Green (Zhang et al, 2020a; Hou et al, 2021) and TaqMan qPCR assays (Chen et al, 2022) for PCV4. To assess the intra-assay repeatability and inter-assay reproducibility of the tqPCR, three different concentrations of each standard DNA were tested in triplicate on six different runs performed by two different operators on different days (Bustin et al, 2009). As shown in Table 2, the developed tqPCR assay can be used as an accurate and reliable differential diagnostic tool for assessing PCV2, PCV3, and PCV4 (Broeders et al, 2014).

In our study, the prevalence of PCV2, PCV3, and PCV4 at individual pig and pig farm levels was 13.8%, 25.4%, and 3.8%, and 46.5%, 63.6%, and 19.7%, respectively (Fig. 4). The individual pig-level prevalence of PCV4 was consistent with that of a previous report (Nguyen et al, 2021). In contrast, it was lower than those of some Chinese prevalence studies, which reported 12.8% (Zhang et al, 2020b) to 37.5% (Hou et al, 2021). Various factors, such as the country, region, and farm surveyed, the health status of the tested pigs, and the diagnostic method, could explain the differences in the observed prevalence. The prevalence at the farm level was higher than that at the individual pig level, which means that PCV4 is likely to occur endemically in Korean pig farms in the future, like PCV2 and PCV3. Previous studies have revealed that PCV4 has wide tissue tropism and could be a potential pathogen causing different clinical presentations, including PMWS, PDNS, diarrhea, abortion, and neurological symptoms. Furthermore, co-infection of PCV4 with PCV3 and singular infection with PCV4 and other swine pathogens are common in infected pigs (Zhang et al, 2020a; Zhang et al, 2020b; Sun et al, 2021; Tian et al, 2021). In this study, although the scope of the research was limited to the prevalence and co-infection status of three PCVs using the newly developed tqPCR assay, further studies are needed on the co-infection of PCVs with other swine pathogens such as PRRSV and PPV. Through this study, PCV2, PCV2, and PCV3 were found to co-circulate in the form of singular infections and co-infections in Korean pig population (Fig. 4). Although pathogenesis studies have not been conducted in animals with PCV4 isolates, PCV4 is hypothesized to be a potential pathogen associated with various clinical symptoms that are like those of PCV2 or PCV3 infections. Therefore, further etiological, epidemiological, and pathological studies are urgently needed to prepare the clinical impacts of PCV4 single and mixed infections with PCV2, PCV3, and other pathogens.

In the present study, we successfully developed a qPCR assay that could differentially detect PCV2, PCV3, and PCV4 in a single reaction with high specificity, sensitivity, and reliability. Based on the clinical evaluation results of the assay, PCV4 is confirmed to be widespread, and co-infection with three pathogenic PCVs is common in Korean pig herds. The developed tqPCR assay will serve as a promising tool for etiological and epidemiological studies of the three pathogenic PCVs.

This work was supported by the Commercialization Promotion Agency for R&D Outcomes (COMPA) grant funded by the Korean Government (Ministry of Science and ICT) (R&D project No. 1711139487), the Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through the Animal Disease Management Technology Development Program (321015-01-1-CG000), and “Cooperative Research Program for Agriculture Science and Technology Development (Project No. PJ01561102)” funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA), Rural Development Administration (RDA), Republic of Korea.

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study complied with the ethical requirements of the Animal and Plant Quarantine Agency and Kyungpook National University, Republic of Korea.

No potential conflict of interest relevant to this article was reported.