Korean Journal of
Veterinary Service

Feline respiratory disease complex (FRDC) is globally reported disease syndrome characterized by acute and contagious respiratory or ocular diseases caused by one or multiple pathogens; a variety of viral and bacterial pathogens are associated with outbreaks of FRDC, such as feline calicivirus (FCV), feline herpesvirus 1 (FHV-1), Bordetella bronchiseptica (B. bronchiseptica), Chlamydia felis (C. felis), and Mycoplasma felis (M. felis) (Cai et al, 2002; Di Martino et al, 2007; Cohn, 2011; Fernandez et al, 2017). Of these, FCV and FHV-1 are considered the primary viral pathogens that are most frequently identified in cats with FRDC (Radford et al, 2009; Thiry et al, 2009; Hoffmann et al, 2022). Although extremely rare, certain subtypes of influenza A viruses (IAVs) are also associated with FRDC, and concern has been raised regarding their zoonotic potential (Borland et al, 2020; Frymus et al, 2021).

Since the clinical signs of respiratory disease caused by FCV, FHV-1, or IAV are indistinguishable in cats, laboratory testing is required for accurate and differential diagnosis of the pathogens involved FRDC (Helps et al, 2005; Litster et al, 2015; Nguyen et al, 2019; Lobova et al, 2019). Real-time quantitative polymerase chain reaction (qPCR) and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) assays have been preferentially used to detect various pathogens from clinical samples obtained FRDC-affected cats due to their higher specificity, sensitivity, and quantitative capability over conventional gel-based PCR (cPCR) and cRT-PCR. Several qPCR and qRT-PCR assays have also been developed in a monoplex format for FCV (Scansen et al, 2004; Wilhelm and Truyen, 2006; Chander et al, 2007; Abd-Eldaim et al, 2009; Baek et al, 2023), FHV-1 (Vögtlin et al, 2002; Hussein and Field, 2008), and IAV (Spackman and Suarez, 2008; Nagy et al, 2021), in a multiplex format such as duplex qPCR for C. felis and FHV-1 (Helps et al, 2003), as triplex qRT-PCR for FCV, FHV-1, and feline parvovirus (FPV) (Cao et al, 2022), as triplex qPCR for B. bronchiseptica, M. felis, and C. felis (Kim et al, 2022), as triplex qRT-PCR for FCV, FHV-1, and B. bronchiseptica (Bennett, 2015), or as triplex qRT-PCR for FHV-1, FCV, and C. felis (Helps et al, 2005). However, a tqRT-PCR assay that can simultaneously detect and differentiate FCV, FHV-1, and IAV has not yet been developed.

In the present study, we established a new tqRT-PCR assay that can simultaneously detect and differentiate FHV-1, FCV, and IAV in a single reaction and evaluated its diagnostic performance with feline clinical samples obtained from cats with suspected FRDC. Furthermore, we investigated the prevalence of these three viral pathogens in the Korean cat populations based on the diagnostic results of the tqRT-PCR assay.

Reference pathogens and samples

FCV (894-T strain), FHV-1 (593-J strain), and IAV [A/Canine/Korea/01/07(H3N2)] were used to optimize the tqRT-PCR conditions. Six other feline pathogens, including feline leukemia virus (FLV, Rickard strain), FPV (Philips Roxane strain), feline coronavirus (FCoV, WSU 79-1683(3) strain), B. bronchiseptica (S-55 strain), M. felis (field strain), and C. felis (Baker strain) were obtained from a commercially available vaccine company (CAVC) and the Institute for Veterinary Biomedical Science (IVBS) to evaluate the specificity of the assay (Table 1). To clinically evaluate the tqRT-PCR assay, a total of 120 nasopharyngeal samples were obtained from cats with clinical signs of FRDC in 2022 through collaboration with a companion animal healthcare company (Postbio Co., Ltd, Guri, Gyeonggi-do, Korea). Total nucleic acids were extracted from 200 µL of viral and bacterial stock and clinical samples using a TANBead Nucleic Acid Extraction Kit with fully automated magnetic bead operating platform (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan), according to the manufacturer’s directions. All tested samples and total nucleic acids were allocated and stored at −80℃ until use.

Table 1 . Specificity of the triplex reverse transcription real-time polymerase chain reaction using different feline pathogens and controls.

Pathogen	Strain	Source*	Amplification of target gene†
			FCV (Cy5)	FHV-1 (FAM)	IAV (TR)
Feline calicivirus	894-T	CAVS	+	−	−
Feline herpesvirus 1	593-J	CAVS	−	+	−
Influenza A virus	A/Canine/Korea/01/07(H3N2)	CAVS	−	−	+
Feline leukemia virus	Rickard	CAVS	−	−	−
Feline parvovirus	Philips Roxane	CAVS	−	−	−
Feline coronavirus	WSU 79-1683(3)	CAVS	−	−	−
Bordetella bronchiseptica	S-55	CAVS	−	−	−
Mycoplasma felis	Field strain	IVBS	−	−	−
Chlamydia felis	Baker	CAVS	−	−	−
Non-infected feline sample	-	IVBS	−	−	−
CRFK cell	-	IVBS	−	−	−
MDCK cell	-	IVBS	−	−	−

*CAVS, commercially available vaccine strain; IVBS, Institute for Veterinary Biomedical Science, Kyungpook National University, Korea. ^†Each probe labeled with cyanine 5 (Cy5), 6-carboxyfluorescein (FAM), and Texas red (TR) fluorescent dyes was used to detect the p30 gene of feline calicivirus (FCV), TK gene of feline herpesvirus 1 (FHV-1), and M gene of influenza A virus (IAV), respectively. +, positive reaction; −, negative reaction..

Primers and probes for the tqRT-PCR assay

Three sets of primers and probe were used to establish the tqRT-PCR assay for differential detection of FCV, FHV-1, and IAV in this study. A set of primers and probe for detecting the p30 gene of FCV was taken from a previously described qRT-PCR assay (Baek et al, 2023) with some modification of the reverse primer sequences to facilitate the establishment of the tqRT-PCR conditions (Table 2). The other two sets of primers and probe for FHV-1 and IAV were newly designed using Primer Express software (version 3.0) (Applied Biosystems) based on the conserved gene sequences of FHV-1 thymidine kinase (TK) gene and IAV matrix (M) gene, respectively. To facilitate the establishment of the tqRT-PCR assay, two sets of primers and probe for FHV-1 and IAV were carefully designed so that their melting temperatures were consistent with those of the primers and probe for FCV. No self-dimers, heterodimers, or hairpin formations between the primers and probes were confirmed using OligoAnalyzer software (IDT, Inc., Skokie, IL, USA). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to determine the specificity of each set of primers and probe. All primers and probes for the three viruses showed 100% homology with the corresponding viral target sequences. For the simultaneous and differential detection of the three viral target genes in a single reaction, the probes were labeled differently at the 5’ and 3’ ends with cyanine 5 (Cy5) and BHQ3 for FCV, 6-carboxyfluorescein (FAM) and black hole quencher 1 (BHQ1) for FHV-1, and Texas red and BHQ2 for IAV, according to the manufacturer’s guidelines (BIONICS, Daejeon, Republic of Korea) (Table 2).

Table 2 . Primers and probes used in this study.

Method	Pathogen/gene	Primer/probe	Sequence (5’∼3’)*	Tm (℃)	Amplicon (bp)	Reference
tqRT-PCR	FCV/p30	p30F	GCCAATCAACATGTGGTAAC	59.6	116	Baek et al (2023), Modified
		p30R	GTHAGCACATCATATGCGGC	62.0
		p30P	Cy5-TGTTTGATTTGGCCTGGGCTCTTCG-BHQ3	69.0
	FHV-1/TK	TKF	AGGTAAGAGTTTAACGGCGAAG	62.4	80	This study
		TKR	TTGGTTCTGGGAAGTAGTAAGT	61.1
		TKP	FAM-TCGATTTTCATCCGCTCTGACCAGGT-BHQ1	69.1
	IAV/M	MF	TGGCTAAAGACAAGACCA	58.2	100	This study
		MR	GTCTACGCTGCAGTCCT	60.6
		MP	Texas Red-TCACTGGGCACGGTGAGCG-BHQ2	68.7
qRT-PCR	FCV/p30	FCV for	GTTGGATGAACTACCCGCCAATC	65.1	122	Helps et al (2005)
		FCV rev	CATATGCGGCTCTGATGGCTTGAAACTG	68.8
		FCV FQ	FAM-TCGGTGTTTGATTTGGCCTG -BHQ1	63.2
	FHV-1/TK	Forward	TGGTGCCTATGGAATAGGTAAGAGTT	65.2	65	Bennett (2015)
		Reverse	GTCGATTTTCATCCGCTCTGA	62.4
		Probe	FAM-AACGGCGAAGTACC-BHQ1	54.3
	IAV/M	SVIP-MP-F	GGCCCCCTCAAAGCCGA	66.5	182	Nagy et al (2021)
		SVIP-MP-R	CGTCTACGYTGCAGTCC	60.4
		SVIP-MP-P2	FAM-TCACTKGGCACGGTGAGCGT-BHQ1	69.3

*Primers and probes for the triplex quantitative real-time polymerase chain reaction (tqRT-PCR) and reference qRT-PCR and qPCR assays were designed based on the sequences of the detected p30 gene of feline calicivirus (FCV), TK gene of feline herpesvirus 1 (FHV-1), and M gene of influenza A virus (IAV). Bold sequences of the reverse primers for the FCV p30 gene (p30R) were modified from the previously described qRT-PCR for FCV (Baek et al, 2023) to facilitate the establishment of the tqRT-PCR assay developed in this study..

Construction of RNA and DNA standards

The partial target genes of p30 (FCV), TK (FHV-1), and M (IAV) were amplified with primers for FCV (forward, 5’-AGTCAGCTTTGGGCGTG-3’ and reverse, 5’-TCTCATCCATCCAGTGACG-3’), FHV-1 (forward, 5’-ACCCTCACGACGTTGAAT-3’ and reverse, 5’-CACGTCTGCTACATCAACAT-3’), or IAV (forward, 5’-tgagtcttctaaccgaggtc-3’ and reverse, 5’-gttgacaaaatgaccatcgt-3’) using RNA or DNA templates extracted from reference strains as previously described (Kim et al, 2022; Baek et al, 2023), according to the manufacturer’s instructions. The amplified products were purified and cloned into pTOP TA V2 vector (TOPcloner™ TA core Kit; Enzynomics, Korea) and transformed into Escherichia coli competent cells according to the manufacturer’s instructions (DH5α chemically competent E. coli; Enzynomics, Republic of Korea). Each plasmid containing target gene of FCV, FHV-1, or IAV was digested with EcoRI (Takara Bio, Kusatsu, Japan) and purified using a commercial kit (CleanUP SV kit, GeneAll, Seoul, Republic of Korea). For the RNA viruses (FCV and IAV), the cloned plasmids were transcribed in vitro using a RiboMAX Large Scale RNA Production System-T7 (Promega, Fitchburg, Wisconsin, USA) according to the manufacturer’s instructions. The RNA/DNA concentration of each transcript was determined using a NanoDrop Lite instrument (Thermo Scientific, Waltham, MA, USA), and the copy number of each cloned gene was quantified as previously described (Kim et al, 2022; Baek et al, 2023). The standard RNA/DNA samples were serially diluted by 10-fold (from 10⁶ to 10⁰ copies/reaction) and stored at −80℃ until use.

Optimization of the tqRT-PCR conditions

Before optimization of the tqRT-PCR conditions, each monoplex qRT-PCR assay was performed with FCV-, FHV-1-, or IAV-specific primers and probe set using a commercial qRT-PCR kit (RealHelix™ qRT-PCR Kit [v4], NanoHelix, Daejeon, Korea) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA). To optimize the tqRT-PCR conditions, the concentrations of the three sets of primers and probe were optimized, whereas the other reaction components were maintained at the same concentrations used in the monoplex qRT-PCR reactions. The thermocycling program for the monoplex and triplex qRT-PCR assays was as follows: 30 min at 50℃ for reverse transcription, 15 min at 95℃ for initial denaturation, followed by 40 cycles of 20 s at 95℃ and 1 min at 60℃ for two-step amplification. Fluorescence signals from Cy5, FAM, and Texas red were detected at the end of each annealing step. To interpret the monoplex and triplex qRT-PCR results, samples that produced a cycle threshold (Ct) of less than 37 were considered positive, whereas those with a higher Ct value (>37) were considered negative, according to previously described guidelines (Broeders et al, 2014).

Specificity and sensitivity of the tqRT-PCR assay

To evaluate the specificity of the tqRT-PCR assay, the assay was performed with total nucleic acids extracted from nine feline pathogens (FCV, FHV-1, IAV, FLV, FPV, FCoV, B. bronchiseptica, M. felis, and C. felis), a non-infected feline nasopharyngeal swab sample, and two non-infected cultured cells (CRFK and MDCK cells) of feline and canine origin as negative controls. The sensitivities of the tqRT-PCR and each corresponding monoplex qRT-PCR assay were determined in triplicate using serial dilutions (from 10⁶ to 10⁰ copies/reaction) of each standard RNA/DNA sample containing the target genes of the three viruses described above. For data analysis, CFX96 Touch Real-Time PCR detection software (Bio-Rad) was used to create a standard curve with the Ct values of each 10-fold dilution of the standard RNA/DNA samples (from 10⁶ to 10⁰ copies/reaction). The detection software calculated the correlation coefficient (R²) of the standard curve, standard deviations, and copy numbers of FCV, FHV-1, and IAV of the samples based on the standard curves.

Precision of the tqRT-PCR assay

The repeatability (intra-assay precision) and reproducibility (inter-assay precision) of the tqRT-PCR assay for FCV, FHV-1, and IAV were determined using three different concentrations of the viral RNA/DNA standards. The concentrations of RNA/DNA standards for FCV, FHV-1, and IAV were 10⁶, 10⁴, and 10² copies/reaction (high, medium, and low), respectively. For the intra-assay variability, each dilution was analyzed in triplicate on the same day, whereas for the inter-assay variability, each dilution was analyzed in six independent experiments performed by two different operators on different days according to the MIQE guidelines (Bustin et al, 2009). The coefficient of variation for the Ct values was determined based on the intra- or inter-assay results.

Reference qRT-PCR and qPCR assays

Previously described monoplex qRT-PCR assays for FCV (Help et al, 2005) and IAV (Nagy et al, 2021) or a monoplex qPCR assay for FHV-1 (Bennett, 2015) were adopted as reference assays since these assays target the same genes as the tqRT-PCR assay to be established in this study. The monoplex qRT-PCR/qPCR assays were performed with each viral target gene-specific primers and probe (Table 2) using commercial qRT-PCR or qPCR kit (NanoHelix, Daejeon, Korea) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA) with previously described reaction conditions (Help et al, 2005; Bennett, 2015; Nagy et al, 2021). To interpret these monoplex qRT-PCR and qPCR results, samples that produced a Ct value of less than 37 were considered positive after 40 amplification cycles, whereas those with a higher Ct value (>37) were considered negative according to the same criteria as the tqRT-PCR assay.

Clinical application of the tqRT-PCR assay

To evaluate the diagnostic performance for differential detection of FCV, FHV-1, and IAV, 120 feline clinical samples were tested by the newly developed tqRT-PCR assay, and the results were compared with those obtained by each monoplex qRT-PCR for FCV (Help et al, 2005) and IAV (Nagy et al, 2021) and qPCR for FHV-1 (Bennett, 2015). The diagnostic concordance between the tqRT-PCR and each monoplex qRT-PCR or qPCR was determined using Cohen’s kappa statistics at a 95% confidence interval (CI) (Kwiecien et al, 2011). Given a calculated kappa coefficient value of 0.81∼1.0, the results from these assays were almost 100% concordant. Furthermore, the prevalence and co-infection status of FCV, FHV-1, and IAV in Korean cats were analyzed based on the tqRT-PCR results for the tested 120 clinical samples.

Optimal conditions for the tqRT-PCR assay

The fluorescent signals of Cy5 for FCV, FAM for FHV-1, and Texas red for IAV were successfully generated by the tqRT-PCR under the optimized concentrations of primers and probes (0.4 μM of each primers and 0.2 μM of each probe for FHV-1, FCV, and IAV) as shown in Fig. 1G, and no spurious amplification or significant crosstalk between fluorescent reporter dyes were observed compared with each corresponding monoplex qRT-PCR assay for FCV (Fig. 1A), FHV-1 (Fig. 1C), and IAV (Fig. 1E). The standard curves for the monoplex qRT-PCR or tqRT-PCR assays revealed a linear relationship between the log copy number and Ct value; the correlation coefficient (R²) over the entire concentration range was determined to be >0.99 for each monoplex qRT-PCR and tqRT-PCR assays, demonstrating that the developed tqRT-PCR assay is highly quantitative (Fig. 1B, 1D, 1F, 1H). The efficiency of the tqRT-PCR assay for the FCV p30, FHV-1 TK, and IAV M genes was 93.1%, 101.3%, and 91.1%, respectively; these values were comparable to those of the corresponding monoplex qRT-PCR or qPCR for the FCV p30 gene (93.9%), FHV-1 TK gene (103.3%), and IAV M gene (93.5%) (Fig. 1). These results suggest that the newly developed tqRT-PCR assay can quantitatively detect and differentiate the three target genes of FCV, FHV-1, and IAV from clinical samples in a single reaction (Fig. 1).

Figure 1. Sensitivities and standard curves of monoplex and triplex real-time reverse transcription polymerase chain reaction (qRT-PCR) assays for feline calicivirus (FCV), feline herpesvirus 1 (FHV-1), influenza A virus (IAV). (A and B) monoplex qRT-PCR for FCV; (C and D) monoplex qRT-PCR for FHV-1; (E and F) monoplex qRT-PCR for IAV; (G and H) triplex qRT-PCR for FCV, FHV-1, and IAV. The sensitivities of each monoplex and triplex qRT-PCR assays were determined using 10-fold serial dilutions of each viral RNA/DNA standard (10⁶ to 10⁰ copies/reaction, lines 6∼0). Standard curves were generated from the results of monoplex and triplex qRT-PCR assays using 10-fold serial dilutions of each viral RNA/DNA standard in triplicate. Serial 10-fold dilutions of viral RNA/DNA standard (10⁶ to 10⁰ copies/reaction) were plotted against the cycle threshold (Ct). The correlation coefficient value (R²) and the equation of the regression curve (y) were calculated using CFX Maestro software (Bio-Rad). NC, negative control.

Specificity and sensitivity of the tqRT-PCR assay

Each set of primers and probe for FCV, FHV-1, and IAV specifically amplified the target RNA/DNA of the respective virus only, and no positive results were obtained for any of the other feline pathogens, non-infected feline swab sample, and two culture cells (Table 2). As expected, the target genes of the three viral pathogens were co-amplified using the tqRT-PCR assay from a mixed RNA/DNA sample of FCV, FHV-1, and IAV (Fig. 1G). These results demonstrate that the tqRT-PCR assay was highly specific and can be applied for the differential detection of FCV, FHV-1, and IAV in a single reaction. The limit of detection for the tqRT-PCR assay was below 10 copies/reaction of the target genes for FCV (p30), FHV-1 (TK), and IAV (M), which were equivalent to those of the monoplex qRT-PCR assays (Fig. 1).

Precision of the tqRT-PCR assay

To assess the intra-assay repeatability and inter-assay reproducibility of the tqRT-PCR, three different concentrations of each viral standard RNA/DNA were tested in triplicate on six different runs performed by two different operators on different days (Bustin et al, 2009). The coefficients of variation within runs (intra-assay variability) were 0.18% to 0.64% for FCV, 0.18% to 0.46% for FHV-1, and 0.31% to 0.37% for IAV. The inter-assay variability was 0.27% to 0.53% for FCV, 0.47% to 0.78% for FHV-1, and 0.25% to 0.45% for IAV (Table 3). Therefore, the assay showed high repeatability and reproducibility, with intra-assay and inter-assay coefficients of variation of less than 1%. These results indicate that the tqRT-PCR assay developed in this study can be used as an accurate and reliable diagnostic tool for differentially detecting FCV, FHV-1, and IAV (Broeders et al, 2014).

Table 3 . Intra- and inter-assay coefficients of variation of the triplex real-time reverse transcription polymerase chain reaction (tqRT-PCR) for feline calicivirus (FCV), feline herpesvirus 1 (FHV-1), and influenza A virus (IAV).

Pathogen	Dilution (copies/reaction)	Intra-assay variability				Inter-assay variability
		Mean	SD	CV (%)		Mean	SD	CV (%)
FCV	High (106)	18.85	0.12	0.64		18.82	0.10	0.53
	Medium (104)	25.55	0.11	0.43		25.55	0.11	0.44
	Low (102)	32.46	0.06	0.18		32.49	0.09	0.27
FHV-1	High (106)	21.01	0.09	0.45		21.03	0.10	0.47
	Medium (104)	27.23	0.05	0.18		27.32	0.14	0.52
	Low (102)	33.95	0.16	0.46		33.89	0.27	0.78
IAV	High (106)	18.81	0.07	0.37		18.81	0.09	0.45
	Medium (104)	25.66	0.09	0.33		25.66	0.06	0.25
	Low (102)	33.21	0.10	0.31		33.16	0.09	0.27

The mean value, standard deviation (SD), and coefficient of variation (CV) were determined based on the Ct values for the tqRT-PCR assay..

Clinical application of the tqRT-PCR assay

For clinical evaluation of the newly developed tqRT-PCR assay, 120 feline clinical samples were tested using the tqRT-PCR previously described monoplex qRT-PCR assays for FCV (Helps et al, 2005) and IAV (Nagy et al, 2021) and a monoplex qPCR assay for FHV-1 (Bennett, 2015). The detection rates of FHV-1 and IAV by the new tqRT-PCR assay were 22.5% (27/120) and 0% (0/120), which were consistent with those of the previous monoplex qPCR or qRT-PCR assays for FHV-1 and IAV, with 100% concordance between assays (Table 4). On the other hand, the detection rate of FCV by the new tqRT-PCR was 43.3% (52/120), which was higher than that of the previous monoplex qRT-PCR assay (36.7%, 44/120); there was 93.3% concordance between assays because the previous monoplex qRT-PCR assay failed to detect eight clinical samples that tested FCV positive by the new tqRT-PCR assay (Table 4). Based on the clinical diagnostic results of the new tqRT-PCR assay, the prevalence of FCV, FHV-1, or IAV in 120 clinical samples tested was 43.3%, 22.5%, and 0%, respectively (Table 4). The rate of dual infection with FCV and FHV-1 was 8.3% (10/120) (Fig. 2). These results indicate that FCV is widespread and that co-infection of FCV with FHV-1 occurs frequently in the Korean cat population.

Table 4 . Comparison of diagnostic results between the newly triplex real-time reverse transcription polymerase chain reaction (tqRT-PCR) and previous qRT-PCR and qPCR assays for detection of feline calicivirus (FCV), feline herpesvirus 1 (FHV-1), and influenza A virus (IAV) from 120 feline clinical samples.

Pathogen	Method	No. of tested	No. of positive	Detection rate (%)	Overall agreement between assays (%)†
FCV	New tqRT-PCR	120	52	43.3	93.3
	Previous qRT-PCR	120	44	36.7
FHV-1	New tqRT-PCR	120	27	22.5	100.0
	Previous qPCR	120	27	22.5
IAV	New tqRT-PCR	120	0	0	100.0
	Previous qRT-PCR	120	0	0

^†The positive, negative, and overall agreement between the developed tqRT-PCR and previously described monoplex qRT-PCR or qPCR assay were 84.6% (44/52), 100.0% (68/68), and 93.3% (112/120), respectively, for feline calicivirus (FCV), 100% (27/27), 100% (93/93), and 100% (120/120), respectively, for feline herpesvirus 1 (FHV-1), and 100% (0/0), 100% (120/120), and 100% (120/120), respectively, for influenza A virus (IAV)..

Figure 2. Prevalence and co-infection status for feline calicivirus (FCV), feline herpesvirus 1 (FHV-1), and influenza A virus (IAV) determined using the newly developed triplex real-time reverse transcription polymerase chain reaction assay with 120 clinical samples collected from household cats with clinical signs of feline respiratory disease complex.

Since FCV, FHV-1, and IAV are important viral pathogens associated with FRDC, a tqRT-PCR assay is urgently needed for simultaneous and differential detection of these three viruses in a single reaction, but such a tqRT-PCR assay has not yet been described. Therefore, in this study, we newly developed a TaqMan probe-based tqRT-PCR assay that can differentially detect FCV, FHV-1, and IAV in a reaction and comparatively evaluated the assay’s diagnostic performance with previously described monoplex qRT-PCR assays for FCV (Helps et al, 2005) and IAV (Nagy et al, 2021) and a monoplex qPCR assay for FHV-1 (Bennett, 2015).

The newly developed tqRT-PCR assay with three sets of primers and TaqMan probe designed based on the conserved sequences of the FCV p30, FHV-1 TK, and IAV M genes simultaneously amplified and differentially detected by each viral gene-specific probe in a single reaction without spurious amplification or significant crosstalk between the three fluorescent reporter dyes (Fig. 1). The analytical sensitivities of the assay for the three viruses were determined to be below 10 copies/reaction with standard RNAs for FCV and IAV or standard DNAs for FNV-1 (Fig. 1), which were consistent with those of previously described corresponding monoplex qRT-PCR assays for FCV and IAV (Helps et al, 2005; Nagy et al, 2021) or monoplex qPCR assay for FHV-1 (Bennett, 2015). As shown in Table 3, the new tqRT-PCR assay was demonstrated to have high accuracy for detecting three viral target genes. In the clinical evaluation with respiratory samples collected from FRDC-affected cats, the detection rates of FHV-1 and IAV by the new tqRT-PCR assay were consistent with those of the previous qPCR assay for FHV-1 (Bennett, 2015) and qRT-PCR assay for IAV (Nagy et al, 2021). However, the detection rate of FCV was higher than that of previously described qRT-PCR assay for FCV (Helps et al, 2005), as shown in Table 4. Although the new tqRT-PCR and previous Helps’s qRT-PCR assays targeted the same p30 gene of FCV, the detection rate of the new assay was higher, indicating that primers and probe of the new assay are well designed to be more suitable for the currently circulating FCV strains in Korea. However, considering that FCV is highly mutagenic and that genetically diverse FCV strains may emerge in cat populations in the near future, continuous genetic monitoring of FCV strains in the field and updating of the primers and probe are required to ensure the diagnostic sensitivity and reliability of the developed assay (Spiri, 2022; Baek et al, 2023). On the other hand, considering that it is difficult to collect a large quantity of clinical samples from small companion cats, the new tqRT-PCR assay is more desirable than previous monoplex assays that detect individual viruses in a separate reaction because it can simultaneously detect three viral pathogens in a single reaction with the same nucleic acid templates, saving the tested samples, turnaround time, labor, and resources in diagnostic laboratories. Taken together, all these results suggest that the new tqRT-PCR assay can be applicable for the clinical diagnosis of these three main viral pathogens and will be a promising tool for etiological and epidemiological studies for the FRDC in the field.

Considering the prevalence of these viral pathogens in global cat populations, it is presumed that FCV and FHV-1 are already widely prevalent in the Korean cat population. Nevertheless, there have been few reports on the prevalence of these viral pathogens in the Korean cat population. The prevalence of FCV in Korean cats was reported to be 0% (0/78) in 2008 (Kang and Park, 2008), 2.5% (3/120) in 2020 (Kim et al, 2020), and 7% in 2022 (Lee and Park, 2022); these rates are significantly lower than those reported in China (28.9%, Mao et al, 2022), Japan (21.2%, Cai et al, 2002), the Europe (29∼47%, Helps et al, 2005), the USA (26%, Michael et al, 2021), and Spain (15.3∼49.6%, Fernandez et al, 2017). However, the prevalence of FCV in a recent Korean study (Baek et al, 2023) was determined to be 47.9% (45/94), which was similar to that investigated in this study (44.3%); however, was much higher than those of previous three Korean studies mentioned above (Kang and Park, 2008; Kim et al, 2020; Lee and Park, 2022). These varied prevalence rates of FCV in global cat populations may be due to differences in the investigated countries, cat populations, and diagnostic assays used (Cai et al, 2002; Helps et al, 2005; Fernandez et al, 2017; Michael et al, 2021; Mao et al, 2022). However, as shown in a recent Korean study, in the case of viruses with high genetic diversity, such as FCV, prevalence rates can vary significantly depending on the diagnostic assay used for prevalence studies (Lee and Park, 2022; Baek et al, 2023). Therefore, when conducting a prevalence study for a certain pathogen, the diagnostic method with the best diagnostic performance for the pathogen to be investigated should be selected through a preliminary evaluation of the various diagnostic methods available.

In Korea, the prevalence of FHV-1 was reported in 2008 (Kang and Park, 2008) and 2022 (Lee and Park, 2022). The prevalence of FHV-1 reported in 2008 was determined to be 63% among 78 cats in an animal shelter without FRDC signs (Kang and Park, 2008), but the viral prevalence was reported to be 14.5% in 2022 among 100 hospitalized cats with or without FRDC signs (Lee and Park, 2022). In this study, the prevalence of FHV-1 determined by the new tqRT-PCR assay was 22.5% (Table 4), which was lower than that of previous Kang and Park’s study in 2008 but slightly higher than that of the previous Lee and Park’s study in 2022. Considering that FHV-1 prevalence obtained from our present study (22.5%) and recent Lee and Park’ study (14.5%) was similar to the prevalence reported in Japan (16.7%, Cai et al, 2002), the USA (21%, Michael et al, 2021), and Europe (8∼16%, Helps et al, 2005), it is unusual that the FHV-1 prevalence in Kang and Park’s study (63%) was exceptionally high. Although the reason why the prevalence of FHV-1 in Kang and Park’s study was much higher than those in other recent studies conducted in Korea and other countries remains unknown, it is assumed that the tested cats may have had an increased risk of infection through more exposure to reactivated virus from carriers because the Korean housing environment may have been more stressful than that in other countries at that time (Kang and Park, 2008). The lower prevalence of FHV-1 in the other recent Korean study (Lee and Park, 2022) and our present study suggests that companion cats raised at home have a lower risk for FHV-1 infection than stray cats housed in animal shelters where infected and susceptible cats are comingled in a stressful environment. Further studies are required to mitigate the infection risks for the viral infection and to prevent the outbreaks of these diseases in cats housed animal shelters in Korea.

No IAV-positive case was detected in the 120 feline clinical samples in this study (Table 4). However, it is not surprising given that cats are resistant to IAV and then the viral infections appear to be rare and usually self-limiting in cats (Thiry et al, 2009). Nevertheless, diagnosis and surveillance for IAV infection in cats are required to control of this viral disease since cats have been reported to infected with some subtypes of IAVs in Korea and other countries (Song et al, 2011; Cao et al, 2017) and the potential risk of human infection via IAV-infected cats cannot be excluded (Borland et al, 2020). Therefore, this tqRT-PCR assay that can simultaneously detect IAV and other two important respiratory viruses (FCV and FHV-1) will be helpful for the routine screening of the zoonotic virus from FRDC-affected cats in Korea.

Co-infection with multiple pathogens is frequently found in FRDC-affected cats, resulting in more severe clinical outcomes than infection with a single pathogen (Cohn, 2011; Lee-Fowler, 2014; Fernandez et al, 2017). Among the 120 cats tested in this study, 35.0% or 14.2% were infected with only FCV or FHV-1, respectively, but 8.3% were co-infected with FCV and FHV-1, indicating that co-infections of these two viruses are common in FRDC-affected cats in Korea (Fig. 2). Several previous studies in Korea (Kim et al, 2022; Lee and Park, 2022) and other countries (Cai et al, 2002; Litster et al, 2015; Fernandez et al, 2017; Lovova et al, 2019; Nguyen et al, 2019) have reported co-infections not only with multiple viruses but also with multiple viruses and bacteria. Therefore, further studies are needed to investigate co-infections of the broad spectrum of feline pathogens associated with FRDC and to elucidate the impact of co-infections on the pathogenesis and clinical presentation of co-infected cats in the field.

There are some limitations in this study. First. since we aimed to develop and clinically evaluate the tqRT-PCR assay for three main viral pathogens associated with FRDC, other important bacterial pathogens involved in FRDC outbreaks were not included in the scope of this study. In this regard, we recently developed a tqPCR assay for simultaneous and differential detection of three main bacterial pathogens including B. bronchiseptica, M. felis, and C. felis (Kim et al, 2022). Therefore, more extensive studies are required to investigate the prevalence and co-infection status of these viral and bacterial pathogens associated with FRDC in Korean cat populations. Second, all the clinical samples used in this study were collected from household cats that were hospitalized in animal clinics but not from animal shelters that should be included in prevalence studies of the FRDC in the Korean cat population. Therefore, further studies are required to investigate the prevalence FRDC pathogens between household cats and cats in animal shelters in Korea.

In conclusion, we successfully developed a new tqRT-PCR assay with high specificity, sensitivity, and accuracy for simultaneous and differential detection of three viral pathogens associated with FRDC (FCV, FHV-1, and IAV) in a single reaction. Based on the clinical evaluation of the assay, the prevalence and co-infection status of these three viruses were determined in hospitalized cats in Korea. The new tqRT-PCR assay developed in this study will serve as a promising tool for etiological and epidemiological studies of these three feline viruses, and the data for prevalence of three viruses obtained in this study will contribute to expanding knowledge about the epidemiology of FRDC in Korean cat populations.

This work was supported by the research grants from the Animal and Plant Quarantine Agency (Project No. Z-1543085-2022-23-0302), Ministry of Agriculture, Food and Rural Affairs (MAFRA), Republic of Korea.

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study was conducted in 2022 and was beyond the purview of the Institutional Animal Care and Use Committee (IACUC) at Kyungpook National University (KNU), as the KNU IACUC only evaluates proposals using laboratory animals maintained in indoor facilities and not research involving outdoor animals. Canine and feline clinical samples were collected by practicing veterinarians at local clinics and animal shelters during monitoring, surveillance, and treatment, or during regular medical check-ups, after receiving verbal consent from the owners.

No potential conflict of interest relevant to this article was reported.