Top
Search 닫기

Original Article

Split Viewer

Korean J. Vet. Serv. 2023; 46(1): 15-27

Published online March 30, 2023

https://doi.org/10.7853/kjvs.2023.46.1.15

© The Korean Socitety of Veterinary Service

A triplex real-time PCR assay for simultaneous and differential detection of Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplasma canis in respiratory diseased dogs

Gyu-Tae Jeon 1†, Jong-Min Kim 1†, Jeong-Hyun Park 1, Hye-Ryung Kim 1, Ji-Su Baek 1, Hyo-Ji Lee 1, Yeun-Kyung Shin 2, Oh-Kyu Kwon 2, Hae-Eun Kang 2, Soong-Koo Kim 3, Jung-Hwa Kim 3, Young-Hwan Kim 3, Choi-Kyu Park 1*

1College of Veterinary Medicine & Animal Disease Intervention Center, Kyungpook National University, Daegu 41566, Korea
2Foreign Animal Disease Division, Animal and Plant Quarantine Agency, Gimcheon 39660, Korea
3Gyeongsangbuk-do Veterinary Service Laboratory, Daegu 41405, Korea

Correspondence to : Choi-Kyu Park
E-mail: parkck@knu.ac.kr
https://orcid.org/0000-0002-0784-9061
These first two authors contributed equally to this work.

Received: February 17, 2023; Accepted: March 20, 2023

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Bordetella (B.) bronchiseptica, Mycoplasma (M.) cynos, and M. canis are the major bacterial pathogens that cause canine infectious respiratory disease complex (CIRDC). In this study, we developed a triplex real-time polymerase chain reaction (tqPCR) assay for the differential detection of these bacteria in a single reaction. The assay specifically amplified three bacterial genes with a detection limit of below 10 copies/reaction. The assay showed high repeatability and reproducibility, with coefficients of intra- and inter-assay variations of less than 1%. The diagnostic results of the assay using 94 clinical samples from household dogs with CIRDC clinical signs, the prevalence of B. bronchiseptica, M. cynos, and M. canis was 22.3%, 18.1%, and 20.2%, respectively, indicating that the diagnostic sensitivity was comparable to those of previously reported qPCR assays. The dual infection rate of B. bronchiseptica and M. cynos, B. bronchiseptica and M. canis, and M. cynos and M. canis was 5.3%, 7.4%, and 3.1%, respectively. Moreover, the triple infection rate of B. bronchiseptica, M. cynos, and M. canis was 2.1%. These results indicate that coinfections with B. bronchiseptica, M. cynos, and M. canis have frequently occurred in the Korean dog population. The newly developed tqPCR assay in the present study will be a useful tool for etiological and epidemiological studies on these three CIRDC-associated bacterial pathogens. The prevalence and coinfection data revealed through this study will contribute to expanding knowledge on the epidemiology of CIRDC in the recent Korean dog population.

Keywords Triplex real-time PCR, Dogs, Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis

Canine infectious respiratory disease complex (CIRDC) is a multifactorial respiratory disease syndrome in the global dog population and is caused by various etiological agents. The primary pathogens associated with CIRDC include viral pathogens, such as canine distemper virus (CDV), canine adenovirus 2 (CAdV-2), canine parainfluenza virus 5 (CPIV5), and canine respiratory coronavirus (CRCoV) as well as bacterial pathogens, including Bordetella (B.) bronchiseptica, Mycoplasma (M.) cynos, and M. canis (Preistnall et al, 2014; Reagan and Sykes, 2020; Dong et al, 2022). B. bronchiseptica is commonly involved in respiratory diseases of various animal species and has traditionally been associated with CIRDC as a primary pathogen (Mochizuki et al, 2008; Decaro et al, 2016). Clinical signs of infected dogs can vary from mild respiratory disease to severe pneumonia and even death, depending on the immune status, environmental conditions, and coinfections with other viruses and bacteria. Furthermore, B. bronchiseptica has been frequently detected in the upper respiratory tract of healthy or asymptomatic dogs (Schulz et al, 2014; Lavan and Knesl, 2015), suggesting that asymptomatic carriers can act as sources of infection for susceptible dogs.

To date, more than 15 different Mycoplasma species have been isolated from dogs, most of which are considered commensal organisms, and only a few are pathogenic (Chalker and Brownlie, 2004; Chalker, 2005). M. cynos was first isolated from the lungs of a dog with pneumonia; since then, it has been detected in several other cases of canine respiratory disease, suggesting that it is a primary pathogen associated with CIRDC (Chalker et al, 2004; Jambhekar et al, 2019). The role of other Mycoplasma species in CIRDC remains controversial (Chalker et al, 2004; Priestnall et al, 2014; Jambhekar et al, 2019). However, recent studies have demonstrated a significant relationship between the presence of M. canis and the severity of respiratory clinical signs (Decaro et al, 2016; Maboni et al, 2019). Therefore, M. cynos, and M. canis are routinely listed among the monitored pathogens in dogs with CIRDC (Maboni et al, 2019; Dong et al, 2022).

Since these three bacteria are frequently associated with CIRDC, several conventional polymerase chain reaction (cPCR) and quantitative real-time PCR (qPCR) assays have been developed for their rapid, sensitive, and specific detection in suspected clinical samples. TaqMan probe-based qPCR assays are currently preferred because of their superior sensitivity, specificity, and reliability over cPCR assays (Chalker et al, 2004; Helps et al, 2005; Windsor et al, 2006; Spergser and Rosengarten, 2007; Tizolova et al, 2014; Jinnerot et al, 2015; Maboni et al, 2019; Matsuu et al, 2020; Tallmadge et al, 2020; Dong et al, 2022). So far, several TaqMan probe-based qPCR assays have been developed in a monoplex format for the individual detection of B. bronchiseptica (Helps et al, 2005; Schulz et al, 2014; Tizolova et al, 2014; Jinnerot et al, 2015; Matsuu et al, 2020) or M. cynos (Tallmadge et al, 2020) or duplex format for the simultaneous and differential detection of M. cynos and M. canis (Maboni et al, 2019). However, considering that these three bacterial pathogens are widely distributed in the global dog population and coinfection cases with these bacterial pathogens are common in dogs with CIRDC (Schulz et al, 2014; Lavan and Knesl, 2015; Decaro et al, 2016; Mitchell et al, 2017; Sowman et al, 2018; Day et al, 2020; Dong et al, 2022), it is necessary to develop a more advanced molecular diagnostic assay that can simultaneously and differentially detect these three bacterial pathogens in a single reaction. Recently, a triplex qPCR (tqPCR) assay was developed for the simultaneous detection of these three bacteria in canine clinical samples in the US (Dong et al, 2022). However, the clinical diagnostic performance of the newly developed assay was not fully evaluated in that study because the diagnostic performance of the new assay was compared with an assay that was developed a decade ago, which had low diagnostic sensitivity for currently prevailing canine pathogens (Dong et al, 2022). Therefore, further evaluation studies are needed to establish the suitability of the assay for the diagnosis of canine pathogens in other countries. In Korea, some monoplex cPCR assays have been used for the diagnosis and prevalence studies of these (Hong and Kim, 2012; Koh et al, 2020); however, tqPCR assays have not yet been developed or evaluated for their diagnosis. In this study, a tqPCR assay was developed for the simultaneous and differential detection of these three bacterial pathogens. We evaluated the diagnostic performance of the tqPCR assay using canine clinical samples and investigated the prevalence and coinfection status of the bacterial pathogens in the Korean dog population.

Canine pathogens and clinical samples

B. bronchiseptica (92b strain), M. cynos (field strain), and M. canis (PG14 strain) were used to optimize the tqPCR assay conditions in this study. To evaluate the specificity of this assay, seven canine viruses, including canine distemper virus (CDV, Onderstepoort strain), canine influenza virus (CIV, A/Canine/Korea/01/07[H3N2] strain), canine coronavirus (CCoV, ML-18 strain), canine parainfluenza virus 5 (CPIV5, D008 strain), canine parvovirus (CPV, 7809 16-LP strain), canine adenovirus 2 (CAdV-2, Ditchfield strain), and canine pneumovirus (CPnV, Dog/Bari/100-12/ITA/2012 strain) were obtained from a commercially available vaccine company and Animal Disease Intervention Center (Table 1). For the clinical evaluation of the tqPCR assay, 94 nasopharyngeal samples were obtained from dogs with clinical signs of CIRDC through collaboration with a companion animal healthcare company in 2022 (Postbio Co., Ltd., Guri, Gyeonggi-do, Korea). Total nucleic acids were extracted from 200 μL of a virus stock and clinical samples using a TANBead Nucleic Acid Extraction Kit with a fully automated magnetic bead operating platform (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan), according to the manufacturer’s instructions. All samples and total nucleic acids were allocated and stored at −80℃ until use.

Table 1 . Specificity of the triplex real-time polymerase chain reaction using different canine pathogens and controls

PathogenStrainSource*Amplification of target gene

Bb (FAM)Mcy (Texas red)Mca (Cy5)
Bordetella bronchiseptica92bCAVS+
Mycoplasma cynosField strainADIC+
Mycoplasma canisPG14ADIC+
Canine distemper virusOnderstepoortCAVS
Canine influenza virusA/Canine/Korea/01/07(H3N2)CAVS
Canine coronavirusNL-18CAVS
Canine parainfluenza virus 5D008CAVS
Canine parvovirus7809 16-LPCAVS
Canine adenovirus 2DitchfieldCAVS
Canine pneumovirusDog/Bari/100-12/ITA/2012ADIC
MDCK cell-ADIC

*CAVS, commercially available vaccine strain; ADIC, Animal Disease Intervention Center, Kyungpook National University, Korea.

Each probe labeled with FAM, Texas red, and Cy5 fluorescent dye detected flaA gene of Bordetella bronchiseptica (Bb), 16S rRNA gene of Mycoplasma cynos (Mcy), and 16S rRNA gene of Mycoplasma canis (Mca), respectively. +: positive reaction, and −: negative reaction.



Primers and probes for the tqPCR assay

In the tqPCR assay, three sets of primers and probes were used for the differential detection of B. bronchiseptica, M. cynos, and M. canis. The primers and probe specific for the flagellin structural gene (flaA) of B. bronchiseptica were obtained using a previously described qPCR assay (Kim et al, 2022). The sets of primers and probes for M. cynos and M. canis were designed using Primer Express software (version 3.0) (Applied Biosystems, Foster City, California, USA) based on the conserved sequences of their 16S rRNA genes. Considering the high genetic homology between the two Mycoplasma species (Chalker et al, 2004; Chalker and Brownlie, 2004), common forward and reverse primers were designed to simultaneously amplify the target genes of the two species. However, two different species-specific probes capable of hybridizing to each target gene of M. cynos and M. canis were carefully designed to differentially detect the two species in a single reaction. To facilitate the establishment of the tqPCR assay, two sets of primers and probes for detecting M. cynos and M. canis were carefully designed, thereby ensuring that their melting temperatures were consistent with those of the previously reported primers and probes for detecting B. bronchiseptica. No hairpin, self-dimer, or heterodimer formations between the primers and probes were confirmed using OligoAnalyzer software (IDT, Inc., Skokie, IL, USA). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to determine the specificity of the primers and probes. All primers and probes specific for the three bacterial genes showed 100% homology with the corresponding bacterial sequences. For the simultaneous and differential detection of the three bacterial genes in a single reaction, probes were labeled differently at the 5′ and 3′ ends with 6-carboxyfluorescein (FAM) and black hole quencher 1 (BHQ1) for B. bronchiseptica, Texas red and BHQ2 for M. cynos, and cyanine 5 (Cy5) and BHQ3 for M. canis, according to the manufacturer’s instructions (BIONICS, Daejeon, Republic of Korea) (Table 2).

Table 2 . Primers and probes for the triplex real-time polymerase chain reaction

MethodPathogen/genePrimer/probeSequence (5’–3’)Tm (℃)Amplicon (bp)Reference
tqPCRBb/flaABb-FGAACTCGGCTTCGGACATC62.1116Kim et al. (2022)
Bb-RCGTTGGACTTCAGGACCTTG62.3
Bb-PFAM-TCTGCTCGGCGATGCGGTTGATTTC-BHQ170.4
Mcy/16S rRNAFla-FCCTCCTTTCTACGGAGTACA60.1144This study
Mcy-RCTTTACTATTCAGTTTTCAAAGAACA59.2
Mcy-PTexas red-AATGTTGTGTTTATGTATCTAGTTTTGAGAGAAC-BHQ265.0
Mca/16S rRNAMca-FCCTCCTTTCTACGGAGTACA60.1166This study
Mca-RCTTTACTATTCAGTTTTCAAAGAACA59.2
Mca-PCy5-AATGTCATGTGTCGAGATAACCCGACAGT-BHQ368.8
qPCRBb/flaAFla2AGGCTCCCAAGAGAGAAGGCTT67.0118Tizolova et al. (2014)
Fla12AAACCTGCCGTAATCCAGGC64.7
Fla-FAM3FAM-ACCGGGCAGCTAGGCCGC-BHQ171.1
Mcy/16S rRNAM.cynos-FCAACACACGTGCTACAATGGA60.696Dong et al. (2022)
M.cynos-RTGCAGACTACAATCCGAACTGA60.8
M.cynos-probeFAM-AAGCAAAATGGTGACATCAAGCA-BHQ163.9
Mca/16S rRNAM.canis- FCAACACACGTGCTACAATGGA60.696Dong et al. (2022)
M.canis-RTGCAGACTACAATCCGAACTGA60.8
M.canis-probeFAM-CAAAACGGCGACGTCAAGC-BHQ165.1

Primers and probes for the assays were designed based on the sequences of Bordetella bronchiseptica (Bb) flagellin structural gene (flaA), Mycoplasma cynos (Mcy) 16S rRNA, and Mycoplasma canis (Mca) 16S rRNA.



Construction of DNA standards

Plasmids containing the target genes of B. bronchiseptica (flaA), and M. cynos (16S rRNA) were constructed and used as DNA standards to evaluate the sensitivity and accuracy of the new assay. Target genes of the three bacteria were amplified with forward and reverse primers (Table 2) using DNA templates obtained from the reference strains (Table 1) and a commercial PCR kit (PrimeSTAR® GXL DNA Polymerase; Takara, Shiga, Japan), according to the manufacturer’s instructions. The amplified products were purified and cloned into a pTOP TA V2 vector (TOPcloner™ TA core Kit; Enzynomics, Daejeon, Republic of Korea) and transformed into Escherichia coli competent cells (DH5α chemically competent E. coli; Enzynomics) according to the manufacturer’s instructions. Each plasmid containing target gene of B. bronchiseptica, M. cynos, and M. canis was purified using a commercial kit (GeneAll Expin Combo GP 200 miniprep kit, GeneAll, Seoul, Republic of Korea). The DNA concentration of each plasmid of three bacteria was determined by measuring the absorbance at 260 nm using a NanoDrop Lite instrument (Thermo Fisher Scientific, Waltham, MA, USA), and the copy number of each cloned gene was quantified as previously described (Kim et al, 2022). The standard DNA samples were serially diluted 10-fold (from 106 copies to 1 copy) and stored at −80℃ until further use.

Optimization of the tqPCR conditions

Prior to the optimization of the tqPCR conditions, monoplex qPCR using a B. bronchiseptica-, M. cynos-, or M. canis-specific primer and probe set was performed via a commercial qPCR kit (RealHelix™ qPCR kit [Probe], NanoHelix, Daejeon, Republic of Korea) and CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). To optimize the tqPCR conditions, the concentrations of the three sets of primers and probes were optimized, whereas the other reaction components were maintained at the same concentrations as those used in monoplex reactions. The monoplex qPCR and tqPCR cycling programs comprised the following steps: initial denaturation at 95℃ for 15 min, followed by 40 cycles at 95℃ for 20 s. and amplification: at 60℃ for 40 s. Fluorescence signals from FAM, Texas red, and Cy5 were detected at the end of each annealing step. To interpret the monoplex and tqPCR results, samples with a cycle threshold (Ct) of ≤37 were considered positive, whereas those with a high Ct value (>37) were considered negative, according to previously described (Broeders et al, 2014).

Specificity and sensitivity of the tqPCR assay

To evaluate the specificity of the assay, tqPCR was performed using total nucleic acid samples extracted from 10 canine pathogens (B. bronchiseptica, M. cynos, M. canis, CDV, CIV, CCoV, CPIV5, CPV, CAdV-2, and CPnV), with non-infected cultured cells (MDCK cells) used as the negative control. The sensitivities of the tqPCR and its corresponding monoplex qPCR assays were determined in triplicate using serial dilutions (from 106 to 100 copies/reaction) of each standard plasmid DNA containing the target genes of three bacterial pathogens. For data analysis, CFX96 Touch Real-Time PCR detection software (Bio-Rad) was used to construct a standard curve with the Ct values of each 10-fold dilution of the standard DNA samples (from 106 to 100 copies/reaction). The detection software was used to calculate the correlation coefficient (R2) of the standard curve, standard deviations, and the copy numbers of B. bronchiseptica, M. cynos, and M. canis DNAs of the samples based on the standard curves.

Precision of the tqPCR assay

The repeatability (intra-assay precision) and reproducibility (inter-assay precision) of the tqPCR assay for detecting B. bronchiseptica, M. cynos, and M. canis were determined using three different concentrations of the bacterial DNA standards. The standard DNA concentrations of B. bronchiseptica, M. cynos, and M. canis were 106, 104, and 102 copies/reaction (high, medium, and low), respectively. To assess intra-assay variability, each dilution was analyzed in triplicate on the same day, whereas for inter-assay variability, each dilution was analyzed in six independent experiments performed by two different operators on different days according to the MIQE guidelines (Bustin et al, 2009). The coefficient of variation of Ct values was determined based on the intra- or inter-assay results.

Reference qPCR assays

Reference qPCR assays for B. bronchiseptica, M. cynos and M. canis were carefully selected to comparatively evaluate the diagnostic performance of the novel tqPCR assay. For B. bronchiseptica, the qPCR assay developed by Tizolova et al (2014) was used as a reference assay instead of that developed by Dong et al (2022), because a self-dimer was confirmed in the reverse primer sequence used in that study (Dong et al, 2022). For M. cynos and M. canis, the qPCR assays developed by Dong et al (2022) were used as reference assays because no problems were identified in the designed primers and probes for the pathogens. The qPCR assays were performed with B. bronchiseptica flaA-specific primers (Fla2 and Fla12) and probe (Fla-FAM3), M. cynos 16S rRNA-specific primers and probe (M. cynos F, R and probe), and M. canis 16S rRNA-specific primers and probe (M. canis F, R and probe) (Table 2) using a commercial qPCR kit (RealHelix™ qPCR kit [Probe], NanoHelix) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad), under previously described reaction conditions (Tizolova et al, 2014; Dong et al, 2022). To interpret these qPCR results, samples that yielded a Ct value of ≤37 were considered positive after 40 amplification cycles, whereas those with high Ct values (>37) were considered negative, according to the same criteria as those for the tqPCR assay.

Clinical application of the tqPCR assay

To evaluate the diagnostic performance of the tqPCR assay for the differential detection of B. bronchiseptica, M. cynos, and M. canis, 94 canine clinical samples were tested by the newly developed tqPCR assay, and the results were compared to those of previously described qPCR assays for B. bronchiseptica (Tizolova et al, 2014), M. cynos, and M. canis (Dong et al, 2022). The diagnostic concordance between the tqPCR and previous qPCR assays was determined using Cohen’s kappa statistics at a 95% confidence interval (Kwiecien et al, 2011). As the calculated kappa coefficient value was 0.81∼1.0, the results of these assays were approximately 100% concordant. Furthermore, the prevalence and coinfection status of B. bronchiseptica, M. cynos, and M. canis in Korean domestic dogs were analyzed based on the tqPCR results of the tested clinical samples.

Optimal conditions for the tqPCR assay

For the simultaneous and differential detection of B. bronchiseptica, M. cynos, and M. canis in a single reaction, the primer and probe concentrations were optimized under the same qPCR conditions in a triplex format. Using the optimized concentrations of primers and probes (0.25 μM primers and 0.25 μM probes for B. bronchiseptica, M. cynos, and M. canis), the tqPCR assay simultaneously detected the fluorescent signals of FAM, Texas red, and Cy5 (Fig. 1A, 1C, 1E, and 1G). The standard curves for the monoplex qPCR and tqPCR assays revealed a linear relationship between the log copy number and Ct value. The R2 value over the entire concentration range was >0.99 for each monoplex qPCR and tqPCR assay, demonstrating that the newly developed tqPCR assay is highly quantitative (Fig. 1B, 1D, 1F, and 1H). Therefore, the tqPCR assay can quantitatively amplify the three target genes of B. bronchiseptica, M. cynos, and M. canis in a single reaction without spurious amplification or significant crosstalk among the three fluorescent reporter dyes (Fig. 1).

Fig. 1.Sensitivities and standard curves of monoplex and triplex real-time polymerase chain reaction (qPCR) assays for Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplasma canis. (A and B) Monoplex qPCR for B. bronchiseptica; (C and D) monoplex qPCR for M. cynos; (E and F) monoplex qPCR for M. canis; and (G and H) triplex qPCR (tqPCR) for B. bronchiseptica, M. cynos, and M. canis. The sensitivities of each monoplex qPCR and tqPCR were determined using 10-fold serial dilutions of each bacterial DNA standard (106 to 100 copies/reaction, lines 6-0). Standard curves were constructed based on the results of the monoplex and triplex qPCR assays using 10-fold serial dilutions of each bacterial DNA standard in triplicate. Serial 10-fold dilutions of viral DNA standards (106 to 100 copies/reaction) were plotted against the cycle threshold (Ct) values. The correlation coefficient (R2) and equation of the regression curve (y) were calculated using CFX Maestro software (Bio-Rad). NC, negative control.

Specificity and sensitivity of the tqPCR assay

Each set of primers and probes for B. bronchiseptica, M. cynos, and M. canis specifically amplified the target DNA of the respective bacteria only; no positive results were obtained for any of the other canine pathogens and control culture cells (Table 1). As expected, the target genes of the three bacteria were coamplified using the tqPCR assay from a mixed DNA sample of B. bronchiseptica, M. cynos, and M. canis (Fig. 1G). These results indicate that the tqPCR assay is highly specific and can be applied for the differential detection of B. bronchiseptica, M. cynos, and M. canis in a single reaction. The limit of detection of the tqPCR assay was <10 copies/reaction of target genes, including B. bronchiseptica flaA, M. cynos 16S rRNA, and M. canis 16S rRNA, which was equivalent to that of the monoplex qPCR assays (Fig. 1).

Precision of the tqPCR assay

The coefficient of variation within runs (intra-assay variability) was 0.12%∼0.44% for B. bronchiseptica, 0.36%∼0.82% for M. cynos, and 0.30%∼0.54% for M. canis. The inter-assay variability was 0.35%∼0.66% for B. bronchiseptica, 0.27%∼0.34% for M. cynos, and 0.59%∼0.83% for M. canis (Table 3). Therefore, the assay showed high repeatability and reproducibility, with the coefficients of intra- and inter-assay variation of <1%. These results indicate that the newly developed tqPCR assay is an accurate and reliable diagnostic tool for differentially detecting B. bronchiseptica, M. cynos, and M. canis (Broeders et al, 2014).

Table 3 . Intra- and inter-assay coefficients of variation of the triplex real-time polymerase chain reaction for Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplasma canis

PathogenDilution (copies/reaction)Intra-assay variabilityInter-assay variability


MeanSDCV (%)MeanSDCV (%)
B. bronchisepticaHigh (106)19.320.020.1220.090.070.35
Medium (104)26.160.110.4426.800.150.55
Low (102)33.140.140.4333.680.220.66
M. cynosHigh (106)19.140.070.3618.230.060.33
Medium (104)26.060.110.4125.080.090.34
Low (102)32.330.270.8231.770.090.27
M. canisHigh (106)18.350.060.3018.040.110.59
Medium (104)25.060.140.5425.390.170.69
Low (102)32.040.090.3032.030.270.83

The mean value, standard deviation (SD), and coefficient of variation (CV) were determined based on the Ct values for the tqPCR assay.



Clinical application of the tqPCR assay

For the clinical evaluation of the newly developed tqPCR assay and investigation of the prevalence and coinfection status of B. bronchiseptica, M. cynos, and M. canis in the Korean dog population, 94 canine clinical samples were tested using the tqPCR and previously described qPCR assays (Tizolova et al, 2014; Dong et al, 2022). The detection rates of the newly developed tqPCR assay for B. bronchiseptica, M. cynos, and M. canis were 22.3% (21/94), 18.1% (17/94), and 20.2% (19/94), respectively (Table 4). The detection rates of B. bronchiseptica and M. canis using the tqPCR assay were consistent with those using the previously described qPCR assays (Tizolova et al, 2014; Dong et al, 2022), indicating 100% concordance between the new tqPCR and previously described qPCR assays for detecting B. bronchiseptica and M. canis. However, the tqPCR assay detected one clinical sample that had tested negative for M. cynos in the qPCR assay reported by Dong et al (2022) with a Ct value of 36.8. Thus, the detection rate of M. cynos using the tqPCR assay is slightly higher than that using the previously described qPCR assay (17.0%, 16/94), indicating concordance of 98.9% (93/94) between the assays for detecting M. cynos. These results demonstrate that the newly developed tqPCR assay is useful for the simultaneous and differential diagnosis of B. bronchiseptica, M. cynos, and M. canis in canine field samples. Based on the clinical diagnostic results of the tqPCR assay, the prevalence of B. bronchiseptica, M. cynos, and M. canis in 94 tested clinical samples was 22.3%, 18.1%, and 20.2%, respectively (Table 4). The coinfection analysis of clinical samples indicated that the single infection rate of B. bronchiseptica, M. cynos, and M. canis was 7.4% (7/94), 7.4% (7/94), and 7.4% (7/94), respectively, whereas the dual infection rate of B. bronchiseptica and M. cynos, B. bronchiseptica and M. canis, and M. cynos and M. canis was 5.3% (5/94), 7.4% (7/94), and 3.1% (3/94) respectively. The triple infection rate of B. bronchiseptica, M. cynos, and M. canis was 2.1% (2/94) (Fig. 2). These results indicate that coinfections with B. bronchiseptica. M. cynos, and M. canis have frequently occurred in the recent Korean dog population.

Table 4 . Comparison of diagnostic results between the novel triplex real-time polymerase chain reaction (tqPCR) and previous qPCR assays for detecting Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplasma canis

MethodsPathogenNo. of testedNo. of positiveDetection rate (%)
New tqPCRB. bronchiseptica942122.3
M. cynos*941718.1
M. canis941920.2
Previous qPCRB. bronchiseptica942122.3
M. cynos941617.0
M. canis941920.2

*One clinical sample that tested negative for M. cynos in a previously described qPCR assay (Dong et al, 2022) was determined to be positive in the newly developed tqPCR assay with cycle threshold value of 36.8.

The positive, negative, and overall agreements between the newly developed tqPCR and previously described qPCR assays were all 100% for B. bronchiseptica and M. canis, and 94.1%, 100%, and 98.9% for M. cynos, respectively.



Fig. 2.Prevalence and coinfection status of Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplsama canis determined via the newly developed triplex real-time polymerase chain reaction assay using 94 nasopharyngeal samples collected from respiratory diseased dogs.

CIRDC, also known as kennel cough, is an endemic syndrome caused by multiple viral and bacterial pathogens, including CDV, CPIV5, CAdV-2, CHV-1, CPIV5, CRCoV, B. bronchiseptica, M. cynos, and M. canis (Priestnall et al, 2014; Mitchell et al, 2017; Reagan and Sykes, 2020; Dong et al, 2022). Although CIRDC outbreaks are common in facilities with large dog populations and a continuous intake of new animals, particularly in animal shelters, it also occurs in singly housed dogs. Because the incidence and prevalence of the pathogens associated with CIRDC vary greatly depending on the country, animal population, and time point studied, obtaining etiological and epidemiological information on CIRDC outbreaks in domestic dog populations is essential for the effective management and control of CIRDC in each country. However, although numerous studies have been conducted worldwide (Schulz et al, 2014; Lavan and Knesl, 2015; Decaro et al, 2016; Mitchell et al, 2017; Sowman et al, 2018; Day et al, 2020; Matsuu et al, 2020), only a few recent studies have reported the etiology and epidemiology of CIRDC in Korea (Ko et al, 2020; Koh et al, 2020). Furthermore, the clinical signs of infections caused by different pathogens associated with CIRDC are similar, which makes differential diagnosis challenging (Maboni et al, 2019; Dong et al, 2022). Therefore, in the current study, we developed and evaluated a tqPCR assay that can simultaneously and differentially detect the three main bacterial pathogens (B. bronchiseptica, M. cynos, and M. canis) associated with CIRDC and used the assay to investigate prevalence and coinfection status of these three bacterial pathogens in the Korean dog population.

The newly developed tqPCR assay has some advantages. First, it can specifically and differentially detect the three main bacterial pathogens associated with CIRDC in a single reaction without any cross-reactivity with other canine pathogens (Table 1 and Fig. 1). Second, the sensitivity of the newly developed tqPCR assay was <10 copies/reaction with the standard DNAs of B. bronchiseptica, M. cynos, and M. canis, which was equivalent to that of the corresponding monoplex assays (Fig. 1). Third, in the clinical evaluation of canine clinical samples, the diagnostic sensitivity of the tqPCR assay was comparable to that of the previously described qPCR assays for B. bronchiseptica (Tizolova et al, 2014) and M. canis (Dong et al, 2022) and was higher than that of the previously described qPCR assay for M. cynos (Dong et al, 2022) as shown in Table 4. Considering the difficulty associated with collecting a large quantity of clinical samples from small companion animals, such as pet dogs, the newly developed tqPCR that can simultaneously detect three bacterial pathogens in a single reaction with the same DNA template is more desirable because it not only saves limited clinical samples but also reduces the time and labor required for testing. These results suggest the suitability of the newly developed tqPCR assay for the clinical diagnosis of the three main bacterial pathogens and will be a valuable tool for etiological and epidemiological studies on CIRDC in the Korean dog population.

Despite the endemic occurrence of B. bronchiseptica, M. cynos, and M. canis in the global dog population, only a few studies have reported the prevalence of these bacterial pathogens in the Korean dog population. To the best of our knowledge, only one study has been conducted in an animal shelter located in Gwangju metropolitan city in Korea (Koh et al, 2020). In that study, the prevalence of B. bronchiseptica and M. cynos using bacterial culture method and a previously described cPCR assay (Chalker et al, 2004) was determined to be 22.0% (66/300) and 2.3% (7/300), respectively. However, the prevalence of M. canis was not investigated in that study. In the current study, the prevalence of B. bronchiseptica, M. cynos, and M. canis was similar at 22.3%, 18.1%, and 20.2%, respectively (Table 4). The prevalence of B. bronchiseptica in our study was similar with the prevalence previously reported in Korea (Koh et al, 2020), indicating that this bacterial pathogen endemically circulated in the Korean dog population. The prevalence of M. cynos in our study was considerably higher than that of previously reported in Korea (Koh et al, 2020), but similar to that reported in the US (Lavan and Knesl, 2015; Dong et al, 2022), and lower than that reported in Belgium (Barreto et al, 2020). The prevalence of M. canis in the current study was 20.2%, which similar to that reported in the US (Chalker et al, 2004; Maboni et al, 2019) and Brazil (Barreto et al, 2020) but higher than that reported in Belgium (Canonne et al, 2018) and Slovania (Scholton et al, 2017). The reported global prevalence of the canine CIRDC pathogens, including B. bronchiseptica, M. cynos, and M. canis, varied according to the countries, dog populations and their health status, and diagnostic assays used in those studies (Lavan and Knesl, 2015; Decaro et al, 2016; Mitchell et al, 2017; Sowman et al, 2018; Day et al, 2020; Matsuu et al, 2020; Koh et al, 2020; Dong et al, 2022). Therefore, more systemic and periodical studies are needed to determine the exact prevalence of these causative pathogens in the Korean dog population.

Notably, rates of dual or triple infections with B. bronchiseptica, M. cynos, and/or M. canis was similar to single infection rates for each bacterial pathogen in the current study (Fig. 2). Unlike B. bronchiseptica and M. cynos, which are well-known primary pathogens associated with CIRDC, evidence that M. canis as a primary pathogen of CIRDC is still lacking. However, previous studies have suggested its involvement in mild canine respiratory disease (Chalker et al, 2004; Chalker, 2005; Jambhekar et al, 2019). A coinfection with Mycoplasma and other respiratory pathogens shortens the incubation period, worsens the disease, and leads to more severe macroscopic and microscopic lesions compared with single infection (Maes et al, 2018; Reagan and Sykes, 2020; Lion et al, 2021). Therefore, further studies are needed to elucidate the impacts of coinfections with canine Mycoplasmas and other viral and bacterial pathogens on the pathogenesis and clinical outcomes of coinfected dogs.

This study has some limitations. First, since this study aimed to development of the tqPCR assay for the three main bacteria associated with CIRDC and to investigate their prevalence, major viral pathogens associated with CIRDC were not included in the scope of the study. Second, the clinical samples used in this study were collected from household dogs who visited animal clinics. But no samples were obtained from dogs in animal shelters, an important subpopulation in which the prevalence of CIRDC should be investigated. Therefore, further studies are required to develop more advanced diagnostic assays for various canine pathogens associated with CIRDC and investigate its prevalence in a larger representative sample of the entire Korean dog population including animal shelters.

Conclusively, we developed a tqPCR assay that can simultaneously detect three main bacterial pathogens associated with CIRDC in a single reaction. Based on the clinical diagnostic results of the assay, the prevalence and co-infection status of B. bronchiseptica, M. cynos, and M. canis were determined in the current dog population in Korea. The newly developed tqPCR in this study will useful for etiological and epidemiological studies of these three bacterial pathogens associated with CIRDC.

This work was supported by the fund (Z-1543085-2022- 23-03) by the Research of Animal and Plant Quarantine Agency, Republic of Korea.

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study was conducted in 2022 and was beyond the purview of the Institutional Animal Care and Use Committee (IACUC) at Kyungpook National University (KNU), as the KNU IACUC only evaluates proposals using laboratory animals maintained in indoor facilities and not research involving outdoor animals. Canine and feline clinical samples were collected by practicing veterinarians at local clinics and animal shelters during monitoring, surveillance, and treatment, or during regular medical check-ups, after receiving verbal consent from the owners.

No potential conflict of interest relevant to this article was reported.

  1. Barreto ML, Lemos M, de Souza JB, de Brito SG, Alves ABP, dos Santos Machado L, Pereira VLA, Nascimento ER. 2020. Isolation and identification of Mycoplasma species in dogs. Inter J Environ & Agri Res 6:18-23.
  2. Broeders S, Huber I, Grohmann L, Berben G, Taverniers I, Mazzara M, Morisset D. 2014. Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci Technol 37:115-126.
    CrossRef
  3. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Wittwer CT. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55:611-622.
    Pubmed CrossRef
  4. Canonne AM, Peters I, Roles E, Clercx C. 2018. Detection of specific bacterial agents by quantitative PCR assays in the bronchoalveolar lavage fluid of dogs with eosinophilic bronchopneumopathy vs. dogs with chronic bronchitis and healthy dogs. Vet J 232:52-56.
    Pubmed CrossRef
  5. Chalker VJ. 2005. Canine mycoplasmas. Res Vet Sci 79:1-8.
    Pubmed CrossRef
  6. Chalker VJ and Brownlie J. 2004. Taxonomy of the canine Mollicutes by 16S rRNA gene and 16S/23S rRNA intergenic spacer region sequence comparison. Int J Syst Evol Microbiol 54:537-542.
    Pubmed CrossRef
  7. Chalker VJ, Owen WM, Paterson C, Barker E, Brooks H, Brownlie J. 2004. Mycoplasmas associated with canine infectious respiratory disease. Microbiology 150:3491-3497.
    Pubmed CrossRef
  8. Day MJ, Carey S, Clercx C, Kohn B, MarsilIo F, Thiry E, Freyburger L, Walker DJ. 2020. Aetiology of canine infectious respiratory disease complex and prevalence of its pathogens in Europe. J Comp Pathol 176:86-108.
    Pubmed KoreaMed CrossRef
  9. Decaro N, Mari V, Larocca V, Losurdo M, Lanave G, Lucente MS, Corrente M, Catella C, Bo S, Elia G, Torre G, Grandolfo E, Buonavoglia C. 2016. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease. Vet Microbiol 192:21-25.
    Pubmed KoreaMed CrossRef
  10. Dong J, Tsui WNT, Leng X, Fu J, Lohman M, Anderson J, Hamill V, Lu N, Porter EP, Gray M, Sebhatu T, Brown S, Pogranichniy R, Wang H, Bai J. 2022. Development of a three-panel multiplex real-time PCR assay for simultaneous detection of nine canine respiratory pathogens. J Microbiol Methods 199:106528.
    Pubmed CrossRef
  11. Helps CR, Lait P, Damhuis A, Björnehammar U, Bolta D, Brovida C, Chabanne L, Egberink H, Ferrand G, Fontbonne A, Pennisi MG, Gruffydd-Jones T, Gunn-Moore D, Hartmann K, Lutz H, Malandain E, Möstl K, Stengel C, Graat EA. 2005. Factors associated with upper respiratory tract disease caused by feline herpesvirus, feline calicivirus, Chlamydophila felis and Bordetella bronchiseptica in cats: experience from 218 European catteries. Vet Rec 156:669-673.
    Pubmed CrossRef
  12. Hong SH and Kim O. 2012. Molecular identification of Mycoplasma cynos from laboratory beagle dogs with respiratory disease. Lab Anim Res 28:61-66.
    Pubmed KoreaMed CrossRef
  13. Jambhekar A, Le Boedec K. 2019. A systematic review and meta-analysis of the association between 4 mycoplasma species and lower respiratory tract disease in dogs. J Vet Intern Med 33:1880-1891.
    Pubmed KoreaMed CrossRef
  14. Jinnerot T, Malm K, Wensman JJ. 2015. Development of a TaqMan real-time PCR assay for detection of Bordetella bronchiseptica. Vet Sci 1:14-20.
  15. Kim HR, Jeon GT, Kim JM, Baek JS, Shin YK, Kwon OK, Kang HE, Cho HS, Park CK. 2022. Prevalence of Bordetella bronchiseptica, Mycoplasma felis, and Chlamydia felis using a newly developed triplex real-time polymerase chain reaction assay in Korean cat population. Korean J Vet Serv 45:395-316.
    CrossRef
  16. Ko JH, Park MY, Shin BH, Nam YH, Son JI. 2020. A survey of canine infectious diseases in stray dogs in Gyeonggi Province, Korea. Korean J Vet Serv 43:217-225.
  17. Koh BRD, Kim HN, Kim HJ, Oh AR, Jung BR, Park JS, Lee JG, Kim YH. 2020. A survey of respiratory pathogens in dogs for adoption in Gwangju metropolitan city animal shelter, South Korea. Korean J Vet Serv 43:67-77.
  18. Kwiecien R, Blettner M. 2011. Concordance analysis: part 16 of a series on evaluation of scientific publications. Dtsch Arztebl Int 108:515-521.
    Pubmed KoreaMed CrossRef
  19. Lavan R and Knesl O. 2015. Prevalence of canine infectious respiratory pathogens in asymptomatic dogs presented at US animal shelters. J Small Anim Pract 56:572-576.
    Pubmed KoreaMed CrossRef
  20. Lion A, Secula A, Rançon C, Boulesteix O, Pinard A, Deslis A, Hägglund S, Salem E, Cassard H, Näslund K, Gaudino M, Moreno A, Brocchi E, Delverdier M, Zohari S, Baranowski E, Valarcher JF, Meyer G. 2021. Enhanced pathogenesis caused by influenza D virus and mycoplasma bovis coinfection in calves: a disease severity linked with overexpression of IFN-γ as a key player of the enhanced innate immune response in lungs. Microbiol Spectr 9:e0169021.
    Pubmed KoreaMed CrossRef
  21. Maboni G, Seguel M, Lorton A, Sanchez S. 2019. Canine infectious respiratory disease: New insights into the etiology and epidemiology of associated pathogens. PLoS One 14:e0215817.
    Pubmed KoreaMed CrossRef
  22. Maes D, Sibila M, Kuhnert P, Segalés J, Pieters M. 2018. Update on Mycoplasma hyopneumoniae infections in pigs: Knowledge gaps for improved disease control. Transbound Emerg Dis 65:110-124.
    Pubmed CrossRef
  23. Matsuu A, Yabuki M, Iwahana M. 2020. Molecular detection of canine respiratory pathogens between 2017 and 2018 in Japan. J Vet Med Sci 82:690-694.
    Pubmed KoreaMed CrossRef
  24. Mitchell JA, Cardwell JM, Leach H, Walker CA, Le Poder S, Decaro N, Rusvai M, Egberink H, Rottier P, Fernandez M, Fragkiadaki E, Brownlie J. 2017. European surveillance of emerging pathogens associated with canine infectious respiratory disease. Vet Microbiol 212:31-38.
    Pubmed KoreaMed CrossRef
  25. Mochizuki M, Yachi A, Ohsima T, Ishida T. 2008. Etiologic study of upper respiratory infections of household dogs. J Vet Med Sci 70:563-569.
    Pubmed CrossRef
  26. Priestnall SL, Mitchell JA, Walker CA, Brownlie J. 2014. New and emerging pathogens in canine infectious respiratory disease. Vet Pathol 51:492-504.
    Pubmed CrossRef
  27. Reagan KL and Sykes JE. 2020. Canine infectious respiratory disease. Vet Clin North Am Small Anim Pract 50:405-418.
    Pubmed KoreaMed CrossRef
  28. Scholten SS, Tozon N, Koprivec S, Florjancic M. 2017. Molecular detection and seroprevalence of mycoplasmas in clinically healthy working dogs. Slovenian Vet Res 54:155-161.
    CrossRef
  29. Schulz BS, Kurz S, Weber K, Hartmann K. 2014. Detection of respiratory viruses and Bordetella bronchiseptica in dogs with acute respiratory tract infections. Vet J 201:365-369.
    Pubmed KoreaMed CrossRef
  30. Sowman HR, Dunowska M. 2018. A survey of canine respiratory pathogens in New Zealand dogs. N Z Vet J 66:236-242.
    Pubmed CrossRef
  31. Spergser J and Rosengarten R. 2007. Identification and differentiation of canine Mycoplasma isolates by 16S-23S rDNA PCR-RFLP. Vet Microbiol 125:170-174.
    Pubmed CrossRef
  32. Tallmadge RL, Anderson R, Mitchell PK, Forbes ZC, Werner B, Gioia G, Moroni P, Glaser A, Goodman LB. 2020. Characterization of a novel Mycoplasma cynos real-time PCR assay. J Vet Diagn Invest 32:793-801.
    Pubmed KoreaMed CrossRef
  33. Tizolova A, Brun D, Guillot S. 2014. Development of real-time PCR assay for differential detection of Bordetella bronchiseptica and Bordetella parapertussis. Diagn Microbiol Infect Dis 78:347-351.
    Pubmed CrossRef
  34. Windsor RC, Johnson LR, Sykes JE, Drazenovich TL, De Cock HE. 2006. Molecular detection of microbes in nasal tissue of dogs with idiopathic lymphoplasmacytic rhinitis. J Vet Intern Med 20:250-256.
    Pubmed CrossRef

Article

Original Article

Korean J. Vet. Serv. 2023; 46(1): 15-27

Published online March 30, 2023 https://doi.org/10.7853/kjvs.2023.46.1.15

Copyright © The Korean Socitety of Veterinary Service.

A triplex real-time PCR assay for simultaneous and differential detection of Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplasma canis in respiratory diseased dogs

Gyu-Tae Jeon 1†, Jong-Min Kim 1†, Jeong-Hyun Park 1, Hye-Ryung Kim 1, Ji-Su Baek 1, Hyo-Ji Lee 1, Yeun-Kyung Shin 2, Oh-Kyu Kwon 2, Hae-Eun Kang 2, Soong-Koo Kim 3, Jung-Hwa Kim 3, Young-Hwan Kim 3, Choi-Kyu Park 1*

1College of Veterinary Medicine & Animal Disease Intervention Center, Kyungpook National University, Daegu 41566, Korea
2Foreign Animal Disease Division, Animal and Plant Quarantine Agency, Gimcheon 39660, Korea
3Gyeongsangbuk-do Veterinary Service Laboratory, Daegu 41405, Korea

Correspondence to:Choi-Kyu Park
E-mail: parkck@knu.ac.kr
https://orcid.org/0000-0002-0784-9061
These first two authors contributed equally to this work.

Received: February 17, 2023; Accepted: March 20, 2023

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Bordetella (B.) bronchiseptica, Mycoplasma (M.) cynos, and M. canis are the major bacterial pathogens that cause canine infectious respiratory disease complex (CIRDC). In this study, we developed a triplex real-time polymerase chain reaction (tqPCR) assay for the differential detection of these bacteria in a single reaction. The assay specifically amplified three bacterial genes with a detection limit of below 10 copies/reaction. The assay showed high repeatability and reproducibility, with coefficients of intra- and inter-assay variations of less than 1%. The diagnostic results of the assay using 94 clinical samples from household dogs with CIRDC clinical signs, the prevalence of B. bronchiseptica, M. cynos, and M. canis was 22.3%, 18.1%, and 20.2%, respectively, indicating that the diagnostic sensitivity was comparable to those of previously reported qPCR assays. The dual infection rate of B. bronchiseptica and M. cynos, B. bronchiseptica and M. canis, and M. cynos and M. canis was 5.3%, 7.4%, and 3.1%, respectively. Moreover, the triple infection rate of B. bronchiseptica, M. cynos, and M. canis was 2.1%. These results indicate that coinfections with B. bronchiseptica, M. cynos, and M. canis have frequently occurred in the Korean dog population. The newly developed tqPCR assay in the present study will be a useful tool for etiological and epidemiological studies on these three CIRDC-associated bacterial pathogens. The prevalence and coinfection data revealed through this study will contribute to expanding knowledge on the epidemiology of CIRDC in the recent Korean dog population.

Keywords: Triplex real-time PCR, Dogs, Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis

INTRODUCTION

Canine infectious respiratory disease complex (CIRDC) is a multifactorial respiratory disease syndrome in the global dog population and is caused by various etiological agents. The primary pathogens associated with CIRDC include viral pathogens, such as canine distemper virus (CDV), canine adenovirus 2 (CAdV-2), canine parainfluenza virus 5 (CPIV5), and canine respiratory coronavirus (CRCoV) as well as bacterial pathogens, including Bordetella (B.) bronchiseptica, Mycoplasma (M.) cynos, and M. canis (Preistnall et al, 2014; Reagan and Sykes, 2020; Dong et al, 2022). B. bronchiseptica is commonly involved in respiratory diseases of various animal species and has traditionally been associated with CIRDC as a primary pathogen (Mochizuki et al, 2008; Decaro et al, 2016). Clinical signs of infected dogs can vary from mild respiratory disease to severe pneumonia and even death, depending on the immune status, environmental conditions, and coinfections with other viruses and bacteria. Furthermore, B. bronchiseptica has been frequently detected in the upper respiratory tract of healthy or asymptomatic dogs (Schulz et al, 2014; Lavan and Knesl, 2015), suggesting that asymptomatic carriers can act as sources of infection for susceptible dogs.

To date, more than 15 different Mycoplasma species have been isolated from dogs, most of which are considered commensal organisms, and only a few are pathogenic (Chalker and Brownlie, 2004; Chalker, 2005). M. cynos was first isolated from the lungs of a dog with pneumonia; since then, it has been detected in several other cases of canine respiratory disease, suggesting that it is a primary pathogen associated with CIRDC (Chalker et al, 2004; Jambhekar et al, 2019). The role of other Mycoplasma species in CIRDC remains controversial (Chalker et al, 2004; Priestnall et al, 2014; Jambhekar et al, 2019). However, recent studies have demonstrated a significant relationship between the presence of M. canis and the severity of respiratory clinical signs (Decaro et al, 2016; Maboni et al, 2019). Therefore, M. cynos, and M. canis are routinely listed among the monitored pathogens in dogs with CIRDC (Maboni et al, 2019; Dong et al, 2022).

Since these three bacteria are frequently associated with CIRDC, several conventional polymerase chain reaction (cPCR) and quantitative real-time PCR (qPCR) assays have been developed for their rapid, sensitive, and specific detection in suspected clinical samples. TaqMan probe-based qPCR assays are currently preferred because of their superior sensitivity, specificity, and reliability over cPCR assays (Chalker et al, 2004; Helps et al, 2005; Windsor et al, 2006; Spergser and Rosengarten, 2007; Tizolova et al, 2014; Jinnerot et al, 2015; Maboni et al, 2019; Matsuu et al, 2020; Tallmadge et al, 2020; Dong et al, 2022). So far, several TaqMan probe-based qPCR assays have been developed in a monoplex format for the individual detection of B. bronchiseptica (Helps et al, 2005; Schulz et al, 2014; Tizolova et al, 2014; Jinnerot et al, 2015; Matsuu et al, 2020) or M. cynos (Tallmadge et al, 2020) or duplex format for the simultaneous and differential detection of M. cynos and M. canis (Maboni et al, 2019). However, considering that these three bacterial pathogens are widely distributed in the global dog population and coinfection cases with these bacterial pathogens are common in dogs with CIRDC (Schulz et al, 2014; Lavan and Knesl, 2015; Decaro et al, 2016; Mitchell et al, 2017; Sowman et al, 2018; Day et al, 2020; Dong et al, 2022), it is necessary to develop a more advanced molecular diagnostic assay that can simultaneously and differentially detect these three bacterial pathogens in a single reaction. Recently, a triplex qPCR (tqPCR) assay was developed for the simultaneous detection of these three bacteria in canine clinical samples in the US (Dong et al, 2022). However, the clinical diagnostic performance of the newly developed assay was not fully evaluated in that study because the diagnostic performance of the new assay was compared with an assay that was developed a decade ago, which had low diagnostic sensitivity for currently prevailing canine pathogens (Dong et al, 2022). Therefore, further evaluation studies are needed to establish the suitability of the assay for the diagnosis of canine pathogens in other countries. In Korea, some monoplex cPCR assays have been used for the diagnosis and prevalence studies of these (Hong and Kim, 2012; Koh et al, 2020); however, tqPCR assays have not yet been developed or evaluated for their diagnosis. In this study, a tqPCR assay was developed for the simultaneous and differential detection of these three bacterial pathogens. We evaluated the diagnostic performance of the tqPCR assay using canine clinical samples and investigated the prevalence and coinfection status of the bacterial pathogens in the Korean dog population.

MATERIALS AND METHODS

Canine pathogens and clinical samples

B. bronchiseptica (92b strain), M. cynos (field strain), and M. canis (PG14 strain) were used to optimize the tqPCR assay conditions in this study. To evaluate the specificity of this assay, seven canine viruses, including canine distemper virus (CDV, Onderstepoort strain), canine influenza virus (CIV, A/Canine/Korea/01/07[H3N2] strain), canine coronavirus (CCoV, ML-18 strain), canine parainfluenza virus 5 (CPIV5, D008 strain), canine parvovirus (CPV, 7809 16-LP strain), canine adenovirus 2 (CAdV-2, Ditchfield strain), and canine pneumovirus (CPnV, Dog/Bari/100-12/ITA/2012 strain) were obtained from a commercially available vaccine company and Animal Disease Intervention Center (Table 1). For the clinical evaluation of the tqPCR assay, 94 nasopharyngeal samples were obtained from dogs with clinical signs of CIRDC through collaboration with a companion animal healthcare company in 2022 (Postbio Co., Ltd., Guri, Gyeonggi-do, Korea). Total nucleic acids were extracted from 200 μL of a virus stock and clinical samples using a TANBead Nucleic Acid Extraction Kit with a fully automated magnetic bead operating platform (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan), according to the manufacturer’s instructions. All samples and total nucleic acids were allocated and stored at −80℃ until use.

Table 1 . Specificity of the triplex real-time polymerase chain reaction using different canine pathogens and controls.

PathogenStrainSource*Amplification of target gene

Bb (FAM)Mcy (Texas red)Mca (Cy5)
Bordetella bronchiseptica92bCAVS+
Mycoplasma cynosField strainADIC+
Mycoplasma canisPG14ADIC+
Canine distemper virusOnderstepoortCAVS
Canine influenza virusA/Canine/Korea/01/07(H3N2)CAVS
Canine coronavirusNL-18CAVS
Canine parainfluenza virus 5D008CAVS
Canine parvovirus7809 16-LPCAVS
Canine adenovirus 2DitchfieldCAVS
Canine pneumovirusDog/Bari/100-12/ITA/2012ADIC
MDCK cell-ADIC

*CAVS, commercially available vaccine strain; ADIC, Animal Disease Intervention Center, Kyungpook National University, Korea..

Each probe labeled with FAM, Texas red, and Cy5 fluorescent dye detected flaA gene of Bordetella bronchiseptica (Bb), 16S rRNA gene of Mycoplasma cynos (Mcy), and 16S rRNA gene of Mycoplasma canis (Mca), respectively. +: positive reaction, and −: negative reaction..



Primers and probes for the tqPCR assay

In the tqPCR assay, three sets of primers and probes were used for the differential detection of B. bronchiseptica, M. cynos, and M. canis. The primers and probe specific for the flagellin structural gene (flaA) of B. bronchiseptica were obtained using a previously described qPCR assay (Kim et al, 2022). The sets of primers and probes for M. cynos and M. canis were designed using Primer Express software (version 3.0) (Applied Biosystems, Foster City, California, USA) based on the conserved sequences of their 16S rRNA genes. Considering the high genetic homology between the two Mycoplasma species (Chalker et al, 2004; Chalker and Brownlie, 2004), common forward and reverse primers were designed to simultaneously amplify the target genes of the two species. However, two different species-specific probes capable of hybridizing to each target gene of M. cynos and M. canis were carefully designed to differentially detect the two species in a single reaction. To facilitate the establishment of the tqPCR assay, two sets of primers and probes for detecting M. cynos and M. canis were carefully designed, thereby ensuring that their melting temperatures were consistent with those of the previously reported primers and probes for detecting B. bronchiseptica. No hairpin, self-dimer, or heterodimer formations between the primers and probes were confirmed using OligoAnalyzer software (IDT, Inc., Skokie, IL, USA). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to determine the specificity of the primers and probes. All primers and probes specific for the three bacterial genes showed 100% homology with the corresponding bacterial sequences. For the simultaneous and differential detection of the three bacterial genes in a single reaction, probes were labeled differently at the 5′ and 3′ ends with 6-carboxyfluorescein (FAM) and black hole quencher 1 (BHQ1) for B. bronchiseptica, Texas red and BHQ2 for M. cynos, and cyanine 5 (Cy5) and BHQ3 for M. canis, according to the manufacturer’s instructions (BIONICS, Daejeon, Republic of Korea) (Table 2).

Table 2 . Primers and probes for the triplex real-time polymerase chain reaction.

MethodPathogen/genePrimer/probeSequence (5’–3’)Tm (℃)Amplicon (bp)Reference
tqPCRBb/flaABb-FGAACTCGGCTTCGGACATC62.1116Kim et al. (2022)
Bb-RCGTTGGACTTCAGGACCTTG62.3
Bb-PFAM-TCTGCTCGGCGATGCGGTTGATTTC-BHQ170.4
Mcy/16S rRNAFla-FCCTCCTTTCTACGGAGTACA60.1144This study
Mcy-RCTTTACTATTCAGTTTTCAAAGAACA59.2
Mcy-PTexas red-AATGTTGTGTTTATGTATCTAGTTTTGAGAGAAC-BHQ265.0
Mca/16S rRNAMca-FCCTCCTTTCTACGGAGTACA60.1166This study
Mca-RCTTTACTATTCAGTTTTCAAAGAACA59.2
Mca-PCy5-AATGTCATGTGTCGAGATAACCCGACAGT-BHQ368.8
qPCRBb/flaAFla2AGGCTCCCAAGAGAGAAGGCTT67.0118Tizolova et al. (2014)
Fla12AAACCTGCCGTAATCCAGGC64.7
Fla-FAM3FAM-ACCGGGCAGCTAGGCCGC-BHQ171.1
Mcy/16S rRNAM.cynos-FCAACACACGTGCTACAATGGA60.696Dong et al. (2022)
M.cynos-RTGCAGACTACAATCCGAACTGA60.8
M.cynos-probeFAM-AAGCAAAATGGTGACATCAAGCA-BHQ163.9
Mca/16S rRNAM.canis- FCAACACACGTGCTACAATGGA60.696Dong et al. (2022)
M.canis-RTGCAGACTACAATCCGAACTGA60.8
M.canis-probeFAM-CAAAACGGCGACGTCAAGC-BHQ165.1

Primers and probes for the assays were designed based on the sequences of Bordetella bronchiseptica (Bb) flagellin structural gene (flaA), Mycoplasma cynos (Mcy) 16S rRNA, and Mycoplasma canis (Mca) 16S rRNA..



Construction of DNA standards

Plasmids containing the target genes of B. bronchiseptica (flaA), and M. cynos (16S rRNA) were constructed and used as DNA standards to evaluate the sensitivity and accuracy of the new assay. Target genes of the three bacteria were amplified with forward and reverse primers (Table 2) using DNA templates obtained from the reference strains (Table 1) and a commercial PCR kit (PrimeSTAR® GXL DNA Polymerase; Takara, Shiga, Japan), according to the manufacturer’s instructions. The amplified products were purified and cloned into a pTOP TA V2 vector (TOPcloner™ TA core Kit; Enzynomics, Daejeon, Republic of Korea) and transformed into Escherichia coli competent cells (DH5α chemically competent E. coli; Enzynomics) according to the manufacturer’s instructions. Each plasmid containing target gene of B. bronchiseptica, M. cynos, and M. canis was purified using a commercial kit (GeneAll Expin Combo GP 200 miniprep kit, GeneAll, Seoul, Republic of Korea). The DNA concentration of each plasmid of three bacteria was determined by measuring the absorbance at 260 nm using a NanoDrop Lite instrument (Thermo Fisher Scientific, Waltham, MA, USA), and the copy number of each cloned gene was quantified as previously described (Kim et al, 2022). The standard DNA samples were serially diluted 10-fold (from 106 copies to 1 copy) and stored at −80℃ until further use.

Optimization of the tqPCR conditions

Prior to the optimization of the tqPCR conditions, monoplex qPCR using a B. bronchiseptica-, M. cynos-, or M. canis-specific primer and probe set was performed via a commercial qPCR kit (RealHelix™ qPCR kit [Probe], NanoHelix, Daejeon, Republic of Korea) and CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). To optimize the tqPCR conditions, the concentrations of the three sets of primers and probes were optimized, whereas the other reaction components were maintained at the same concentrations as those used in monoplex reactions. The monoplex qPCR and tqPCR cycling programs comprised the following steps: initial denaturation at 95℃ for 15 min, followed by 40 cycles at 95℃ for 20 s. and amplification: at 60℃ for 40 s. Fluorescence signals from FAM, Texas red, and Cy5 were detected at the end of each annealing step. To interpret the monoplex and tqPCR results, samples with a cycle threshold (Ct) of ≤37 were considered positive, whereas those with a high Ct value (>37) were considered negative, according to previously described (Broeders et al, 2014).

Specificity and sensitivity of the tqPCR assay

To evaluate the specificity of the assay, tqPCR was performed using total nucleic acid samples extracted from 10 canine pathogens (B. bronchiseptica, M. cynos, M. canis, CDV, CIV, CCoV, CPIV5, CPV, CAdV-2, and CPnV), with non-infected cultured cells (MDCK cells) used as the negative control. The sensitivities of the tqPCR and its corresponding monoplex qPCR assays were determined in triplicate using serial dilutions (from 106 to 100 copies/reaction) of each standard plasmid DNA containing the target genes of three bacterial pathogens. For data analysis, CFX96 Touch Real-Time PCR detection software (Bio-Rad) was used to construct a standard curve with the Ct values of each 10-fold dilution of the standard DNA samples (from 106 to 100 copies/reaction). The detection software was used to calculate the correlation coefficient (R2) of the standard curve, standard deviations, and the copy numbers of B. bronchiseptica, M. cynos, and M. canis DNAs of the samples based on the standard curves.

Precision of the tqPCR assay

The repeatability (intra-assay precision) and reproducibility (inter-assay precision) of the tqPCR assay for detecting B. bronchiseptica, M. cynos, and M. canis were determined using three different concentrations of the bacterial DNA standards. The standard DNA concentrations of B. bronchiseptica, M. cynos, and M. canis were 106, 104, and 102 copies/reaction (high, medium, and low), respectively. To assess intra-assay variability, each dilution was analyzed in triplicate on the same day, whereas for inter-assay variability, each dilution was analyzed in six independent experiments performed by two different operators on different days according to the MIQE guidelines (Bustin et al, 2009). The coefficient of variation of Ct values was determined based on the intra- or inter-assay results.

Reference qPCR assays

Reference qPCR assays for B. bronchiseptica, M. cynos and M. canis were carefully selected to comparatively evaluate the diagnostic performance of the novel tqPCR assay. For B. bronchiseptica, the qPCR assay developed by Tizolova et al (2014) was used as a reference assay instead of that developed by Dong et al (2022), because a self-dimer was confirmed in the reverse primer sequence used in that study (Dong et al, 2022). For M. cynos and M. canis, the qPCR assays developed by Dong et al (2022) were used as reference assays because no problems were identified in the designed primers and probes for the pathogens. The qPCR assays were performed with B. bronchiseptica flaA-specific primers (Fla2 and Fla12) and probe (Fla-FAM3), M. cynos 16S rRNA-specific primers and probe (M. cynos F, R and probe), and M. canis 16S rRNA-specific primers and probe (M. canis F, R and probe) (Table 2) using a commercial qPCR kit (RealHelix™ qPCR kit [Probe], NanoHelix) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad), under previously described reaction conditions (Tizolova et al, 2014; Dong et al, 2022). To interpret these qPCR results, samples that yielded a Ct value of ≤37 were considered positive after 40 amplification cycles, whereas those with high Ct values (>37) were considered negative, according to the same criteria as those for the tqPCR assay.

Clinical application of the tqPCR assay

To evaluate the diagnostic performance of the tqPCR assay for the differential detection of B. bronchiseptica, M. cynos, and M. canis, 94 canine clinical samples were tested by the newly developed tqPCR assay, and the results were compared to those of previously described qPCR assays for B. bronchiseptica (Tizolova et al, 2014), M. cynos, and M. canis (Dong et al, 2022). The diagnostic concordance between the tqPCR and previous qPCR assays was determined using Cohen’s kappa statistics at a 95% confidence interval (Kwiecien et al, 2011). As the calculated kappa coefficient value was 0.81∼1.0, the results of these assays were approximately 100% concordant. Furthermore, the prevalence and coinfection status of B. bronchiseptica, M. cynos, and M. canis in Korean domestic dogs were analyzed based on the tqPCR results of the tested clinical samples.

RESULTS

Optimal conditions for the tqPCR assay

For the simultaneous and differential detection of B. bronchiseptica, M. cynos, and M. canis in a single reaction, the primer and probe concentrations were optimized under the same qPCR conditions in a triplex format. Using the optimized concentrations of primers and probes (0.25 μM primers and 0.25 μM probes for B. bronchiseptica, M. cynos, and M. canis), the tqPCR assay simultaneously detected the fluorescent signals of FAM, Texas red, and Cy5 (Fig. 1A, 1C, 1E, and 1G). The standard curves for the monoplex qPCR and tqPCR assays revealed a linear relationship between the log copy number and Ct value. The R2 value over the entire concentration range was >0.99 for each monoplex qPCR and tqPCR assay, demonstrating that the newly developed tqPCR assay is highly quantitative (Fig. 1B, 1D, 1F, and 1H). Therefore, the tqPCR assay can quantitatively amplify the three target genes of B. bronchiseptica, M. cynos, and M. canis in a single reaction without spurious amplification or significant crosstalk among the three fluorescent reporter dyes (Fig. 1).

Figure 1. Sensitivities and standard curves of monoplex and triplex real-time polymerase chain reaction (qPCR) assays for Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplasma canis. (A and B) Monoplex qPCR for B. bronchiseptica; (C and D) monoplex qPCR for M. cynos; (E and F) monoplex qPCR for M. canis; and (G and H) triplex qPCR (tqPCR) for B. bronchiseptica, M. cynos, and M. canis. The sensitivities of each monoplex qPCR and tqPCR were determined using 10-fold serial dilutions of each bacterial DNA standard (106 to 100 copies/reaction, lines 6-0). Standard curves were constructed based on the results of the monoplex and triplex qPCR assays using 10-fold serial dilutions of each bacterial DNA standard in triplicate. Serial 10-fold dilutions of viral DNA standards (106 to 100 copies/reaction) were plotted against the cycle threshold (Ct) values. The correlation coefficient (R2) and equation of the regression curve (y) were calculated using CFX Maestro software (Bio-Rad). NC, negative control.

Specificity and sensitivity of the tqPCR assay

Each set of primers and probes for B. bronchiseptica, M. cynos, and M. canis specifically amplified the target DNA of the respective bacteria only; no positive results were obtained for any of the other canine pathogens and control culture cells (Table 1). As expected, the target genes of the three bacteria were coamplified using the tqPCR assay from a mixed DNA sample of B. bronchiseptica, M. cynos, and M. canis (Fig. 1G). These results indicate that the tqPCR assay is highly specific and can be applied for the differential detection of B. bronchiseptica, M. cynos, and M. canis in a single reaction. The limit of detection of the tqPCR assay was <10 copies/reaction of target genes, including B. bronchiseptica flaA, M. cynos 16S rRNA, and M. canis 16S rRNA, which was equivalent to that of the monoplex qPCR assays (Fig. 1).

Precision of the tqPCR assay

The coefficient of variation within runs (intra-assay variability) was 0.12%∼0.44% for B. bronchiseptica, 0.36%∼0.82% for M. cynos, and 0.30%∼0.54% for M. canis. The inter-assay variability was 0.35%∼0.66% for B. bronchiseptica, 0.27%∼0.34% for M. cynos, and 0.59%∼0.83% for M. canis (Table 3). Therefore, the assay showed high repeatability and reproducibility, with the coefficients of intra- and inter-assay variation of <1%. These results indicate that the newly developed tqPCR assay is an accurate and reliable diagnostic tool for differentially detecting B. bronchiseptica, M. cynos, and M. canis (Broeders et al, 2014).

Table 3 . Intra- and inter-assay coefficients of variation of the triplex real-time polymerase chain reaction for Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplasma canis.

PathogenDilution (copies/reaction)Intra-assay variabilityInter-assay variability


MeanSDCV (%)MeanSDCV (%)
B. bronchisepticaHigh (106)19.320.020.1220.090.070.35
Medium (104)26.160.110.4426.800.150.55
Low (102)33.140.140.4333.680.220.66
M. cynosHigh (106)19.140.070.3618.230.060.33
Medium (104)26.060.110.4125.080.090.34
Low (102)32.330.270.8231.770.090.27
M. canisHigh (106)18.350.060.3018.040.110.59
Medium (104)25.060.140.5425.390.170.69
Low (102)32.040.090.3032.030.270.83

The mean value, standard deviation (SD), and coefficient of variation (CV) were determined based on the Ct values for the tqPCR assay..



Clinical application of the tqPCR assay

For the clinical evaluation of the newly developed tqPCR assay and investigation of the prevalence and coinfection status of B. bronchiseptica, M. cynos, and M. canis in the Korean dog population, 94 canine clinical samples were tested using the tqPCR and previously described qPCR assays (Tizolova et al, 2014; Dong et al, 2022). The detection rates of the newly developed tqPCR assay for B. bronchiseptica, M. cynos, and M. canis were 22.3% (21/94), 18.1% (17/94), and 20.2% (19/94), respectively (Table 4). The detection rates of B. bronchiseptica and M. canis using the tqPCR assay were consistent with those using the previously described qPCR assays (Tizolova et al, 2014; Dong et al, 2022), indicating 100% concordance between the new tqPCR and previously described qPCR assays for detecting B. bronchiseptica and M. canis. However, the tqPCR assay detected one clinical sample that had tested negative for M. cynos in the qPCR assay reported by Dong et al (2022) with a Ct value of 36.8. Thus, the detection rate of M. cynos using the tqPCR assay is slightly higher than that using the previously described qPCR assay (17.0%, 16/94), indicating concordance of 98.9% (93/94) between the assays for detecting M. cynos. These results demonstrate that the newly developed tqPCR assay is useful for the simultaneous and differential diagnosis of B. bronchiseptica, M. cynos, and M. canis in canine field samples. Based on the clinical diagnostic results of the tqPCR assay, the prevalence of B. bronchiseptica, M. cynos, and M. canis in 94 tested clinical samples was 22.3%, 18.1%, and 20.2%, respectively (Table 4). The coinfection analysis of clinical samples indicated that the single infection rate of B. bronchiseptica, M. cynos, and M. canis was 7.4% (7/94), 7.4% (7/94), and 7.4% (7/94), respectively, whereas the dual infection rate of B. bronchiseptica and M. cynos, B. bronchiseptica and M. canis, and M. cynos and M. canis was 5.3% (5/94), 7.4% (7/94), and 3.1% (3/94) respectively. The triple infection rate of B. bronchiseptica, M. cynos, and M. canis was 2.1% (2/94) (Fig. 2). These results indicate that coinfections with B. bronchiseptica. M. cynos, and M. canis have frequently occurred in the recent Korean dog population.

Table 4 . Comparison of diagnostic results between the novel triplex real-time polymerase chain reaction (tqPCR) and previous qPCR assays for detecting Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplasma canis.

MethodsPathogenNo. of testedNo. of positiveDetection rate (%)
New tqPCRB. bronchiseptica942122.3
M. cynos*941718.1
M. canis941920.2
Previous qPCRB. bronchiseptica942122.3
M. cynos941617.0
M. canis941920.2

*One clinical sample that tested negative for M. cynos in a previously described qPCR assay (Dong et al, 2022) was determined to be positive in the newly developed tqPCR assay with cycle threshold value of 36.8..

The positive, negative, and overall agreements between the newly developed tqPCR and previously described qPCR assays were all 100% for B. bronchiseptica and M. canis, and 94.1%, 100%, and 98.9% for M. cynos, respectively..



Figure 2. Prevalence and coinfection status of Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplsama canis determined via the newly developed triplex real-time polymerase chain reaction assay using 94 nasopharyngeal samples collected from respiratory diseased dogs.

DISCUSSION

CIRDC, also known as kennel cough, is an endemic syndrome caused by multiple viral and bacterial pathogens, including CDV, CPIV5, CAdV-2, CHV-1, CPIV5, CRCoV, B. bronchiseptica, M. cynos, and M. canis (Priestnall et al, 2014; Mitchell et al, 2017; Reagan and Sykes, 2020; Dong et al, 2022). Although CIRDC outbreaks are common in facilities with large dog populations and a continuous intake of new animals, particularly in animal shelters, it also occurs in singly housed dogs. Because the incidence and prevalence of the pathogens associated with CIRDC vary greatly depending on the country, animal population, and time point studied, obtaining etiological and epidemiological information on CIRDC outbreaks in domestic dog populations is essential for the effective management and control of CIRDC in each country. However, although numerous studies have been conducted worldwide (Schulz et al, 2014; Lavan and Knesl, 2015; Decaro et al, 2016; Mitchell et al, 2017; Sowman et al, 2018; Day et al, 2020; Matsuu et al, 2020), only a few recent studies have reported the etiology and epidemiology of CIRDC in Korea (Ko et al, 2020; Koh et al, 2020). Furthermore, the clinical signs of infections caused by different pathogens associated with CIRDC are similar, which makes differential diagnosis challenging (Maboni et al, 2019; Dong et al, 2022). Therefore, in the current study, we developed and evaluated a tqPCR assay that can simultaneously and differentially detect the three main bacterial pathogens (B. bronchiseptica, M. cynos, and M. canis) associated with CIRDC and used the assay to investigate prevalence and coinfection status of these three bacterial pathogens in the Korean dog population.

The newly developed tqPCR assay has some advantages. First, it can specifically and differentially detect the three main bacterial pathogens associated with CIRDC in a single reaction without any cross-reactivity with other canine pathogens (Table 1 and Fig. 1). Second, the sensitivity of the newly developed tqPCR assay was <10 copies/reaction with the standard DNAs of B. bronchiseptica, M. cynos, and M. canis, which was equivalent to that of the corresponding monoplex assays (Fig. 1). Third, in the clinical evaluation of canine clinical samples, the diagnostic sensitivity of the tqPCR assay was comparable to that of the previously described qPCR assays for B. bronchiseptica (Tizolova et al, 2014) and M. canis (Dong et al, 2022) and was higher than that of the previously described qPCR assay for M. cynos (Dong et al, 2022) as shown in Table 4. Considering the difficulty associated with collecting a large quantity of clinical samples from small companion animals, such as pet dogs, the newly developed tqPCR that can simultaneously detect three bacterial pathogens in a single reaction with the same DNA template is more desirable because it not only saves limited clinical samples but also reduces the time and labor required for testing. These results suggest the suitability of the newly developed tqPCR assay for the clinical diagnosis of the three main bacterial pathogens and will be a valuable tool for etiological and epidemiological studies on CIRDC in the Korean dog population.

Despite the endemic occurrence of B. bronchiseptica, M. cynos, and M. canis in the global dog population, only a few studies have reported the prevalence of these bacterial pathogens in the Korean dog population. To the best of our knowledge, only one study has been conducted in an animal shelter located in Gwangju metropolitan city in Korea (Koh et al, 2020). In that study, the prevalence of B. bronchiseptica and M. cynos using bacterial culture method and a previously described cPCR assay (Chalker et al, 2004) was determined to be 22.0% (66/300) and 2.3% (7/300), respectively. However, the prevalence of M. canis was not investigated in that study. In the current study, the prevalence of B. bronchiseptica, M. cynos, and M. canis was similar at 22.3%, 18.1%, and 20.2%, respectively (Table 4). The prevalence of B. bronchiseptica in our study was similar with the prevalence previously reported in Korea (Koh et al, 2020), indicating that this bacterial pathogen endemically circulated in the Korean dog population. The prevalence of M. cynos in our study was considerably higher than that of previously reported in Korea (Koh et al, 2020), but similar to that reported in the US (Lavan and Knesl, 2015; Dong et al, 2022), and lower than that reported in Belgium (Barreto et al, 2020). The prevalence of M. canis in the current study was 20.2%, which similar to that reported in the US (Chalker et al, 2004; Maboni et al, 2019) and Brazil (Barreto et al, 2020) but higher than that reported in Belgium (Canonne et al, 2018) and Slovania (Scholton et al, 2017). The reported global prevalence of the canine CIRDC pathogens, including B. bronchiseptica, M. cynos, and M. canis, varied according to the countries, dog populations and their health status, and diagnostic assays used in those studies (Lavan and Knesl, 2015; Decaro et al, 2016; Mitchell et al, 2017; Sowman et al, 2018; Day et al, 2020; Matsuu et al, 2020; Koh et al, 2020; Dong et al, 2022). Therefore, more systemic and periodical studies are needed to determine the exact prevalence of these causative pathogens in the Korean dog population.

Notably, rates of dual or triple infections with B. bronchiseptica, M. cynos, and/or M. canis was similar to single infection rates for each bacterial pathogen in the current study (Fig. 2). Unlike B. bronchiseptica and M. cynos, which are well-known primary pathogens associated with CIRDC, evidence that M. canis as a primary pathogen of CIRDC is still lacking. However, previous studies have suggested its involvement in mild canine respiratory disease (Chalker et al, 2004; Chalker, 2005; Jambhekar et al, 2019). A coinfection with Mycoplasma and other respiratory pathogens shortens the incubation period, worsens the disease, and leads to more severe macroscopic and microscopic lesions compared with single infection (Maes et al, 2018; Reagan and Sykes, 2020; Lion et al, 2021). Therefore, further studies are needed to elucidate the impacts of coinfections with canine Mycoplasmas and other viral and bacterial pathogens on the pathogenesis and clinical outcomes of coinfected dogs.

This study has some limitations. First, since this study aimed to development of the tqPCR assay for the three main bacteria associated with CIRDC and to investigate their prevalence, major viral pathogens associated with CIRDC were not included in the scope of the study. Second, the clinical samples used in this study were collected from household dogs who visited animal clinics. But no samples were obtained from dogs in animal shelters, an important subpopulation in which the prevalence of CIRDC should be investigated. Therefore, further studies are required to develop more advanced diagnostic assays for various canine pathogens associated with CIRDC and investigate its prevalence in a larger representative sample of the entire Korean dog population including animal shelters.

Conclusively, we developed a tqPCR assay that can simultaneously detect three main bacterial pathogens associated with CIRDC in a single reaction. Based on the clinical diagnostic results of the assay, the prevalence and co-infection status of B. bronchiseptica, M. cynos, and M. canis were determined in the current dog population in Korea. The newly developed tqPCR in this study will useful for etiological and epidemiological studies of these three bacterial pathogens associated with CIRDC.

ACKNOWLEDGEMENTS

This work was supported by the fund (Z-1543085-2022- 23-03) by the Research of Animal and Plant Quarantine Agency, Republic of Korea.

ETHICS STATEMENT

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study was conducted in 2022 and was beyond the purview of the Institutional Animal Care and Use Committee (IACUC) at Kyungpook National University (KNU), as the KNU IACUC only evaluates proposals using laboratory animals maintained in indoor facilities and not research involving outdoor animals. Canine and feline clinical samples were collected by practicing veterinarians at local clinics and animal shelters during monitoring, surveillance, and treatment, or during regular medical check-ups, after receiving verbal consent from the owners.

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

Fig 1.

Figure 1.Sensitivities and standard curves of monoplex and triplex real-time polymerase chain reaction (qPCR) assays for Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplasma canis. (A and B) Monoplex qPCR for B. bronchiseptica; (C and D) monoplex qPCR for M. cynos; (E and F) monoplex qPCR for M. canis; and (G and H) triplex qPCR (tqPCR) for B. bronchiseptica, M. cynos, and M. canis. The sensitivities of each monoplex qPCR and tqPCR were determined using 10-fold serial dilutions of each bacterial DNA standard (106 to 100 copies/reaction, lines 6-0). Standard curves were constructed based on the results of the monoplex and triplex qPCR assays using 10-fold serial dilutions of each bacterial DNA standard in triplicate. Serial 10-fold dilutions of viral DNA standards (106 to 100 copies/reaction) were plotted against the cycle threshold (Ct) values. The correlation coefficient (R2) and equation of the regression curve (y) were calculated using CFX Maestro software (Bio-Rad). NC, negative control.
Korean Journal of Veterinary Service 2023; 46: 15-27https://doi.org/10.7853/kjvs.2023.46.1.15

Fig 2.

Figure 2.Prevalence and coinfection status of Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplsama canis determined via the newly developed triplex real-time polymerase chain reaction assay using 94 nasopharyngeal samples collected from respiratory diseased dogs.
Korean Journal of Veterinary Service 2023; 46: 15-27https://doi.org/10.7853/kjvs.2023.46.1.15

Table 1 . Specificity of the triplex real-time polymerase chain reaction using different canine pathogens and controls.

PathogenStrainSource*Amplification of target gene

Bb (FAM)Mcy (Texas red)Mca (Cy5)
Bordetella bronchiseptica92bCAVS+
Mycoplasma cynosField strainADIC+
Mycoplasma canisPG14ADIC+
Canine distemper virusOnderstepoortCAVS
Canine influenza virusA/Canine/Korea/01/07(H3N2)CAVS
Canine coronavirusNL-18CAVS
Canine parainfluenza virus 5D008CAVS
Canine parvovirus7809 16-LPCAVS
Canine adenovirus 2DitchfieldCAVS
Canine pneumovirusDog/Bari/100-12/ITA/2012ADIC
MDCK cell-ADIC

*CAVS, commercially available vaccine strain; ADIC, Animal Disease Intervention Center, Kyungpook National University, Korea..

Each probe labeled with FAM, Texas red, and Cy5 fluorescent dye detected flaA gene of Bordetella bronchiseptica (Bb), 16S rRNA gene of Mycoplasma cynos (Mcy), and 16S rRNA gene of Mycoplasma canis (Mca), respectively. +: positive reaction, and −: negative reaction..


Table 2 . Primers and probes for the triplex real-time polymerase chain reaction.

MethodPathogen/genePrimer/probeSequence (5’–3’)Tm (℃)Amplicon (bp)Reference
tqPCRBb/flaABb-FGAACTCGGCTTCGGACATC62.1116Kim et al. (2022)
Bb-RCGTTGGACTTCAGGACCTTG62.3
Bb-PFAM-TCTGCTCGGCGATGCGGTTGATTTC-BHQ170.4
Mcy/16S rRNAFla-FCCTCCTTTCTACGGAGTACA60.1144This study
Mcy-RCTTTACTATTCAGTTTTCAAAGAACA59.2
Mcy-PTexas red-AATGTTGTGTTTATGTATCTAGTTTTGAGAGAAC-BHQ265.0
Mca/16S rRNAMca-FCCTCCTTTCTACGGAGTACA60.1166This study
Mca-RCTTTACTATTCAGTTTTCAAAGAACA59.2
Mca-PCy5-AATGTCATGTGTCGAGATAACCCGACAGT-BHQ368.8
qPCRBb/flaAFla2AGGCTCCCAAGAGAGAAGGCTT67.0118Tizolova et al. (2014)
Fla12AAACCTGCCGTAATCCAGGC64.7
Fla-FAM3FAM-ACCGGGCAGCTAGGCCGC-BHQ171.1
Mcy/16S rRNAM.cynos-FCAACACACGTGCTACAATGGA60.696Dong et al. (2022)
M.cynos-RTGCAGACTACAATCCGAACTGA60.8
M.cynos-probeFAM-AAGCAAAATGGTGACATCAAGCA-BHQ163.9
Mca/16S rRNAM.canis- FCAACACACGTGCTACAATGGA60.696Dong et al. (2022)
M.canis-RTGCAGACTACAATCCGAACTGA60.8
M.canis-probeFAM-CAAAACGGCGACGTCAAGC-BHQ165.1

Primers and probes for the assays were designed based on the sequences of Bordetella bronchiseptica (Bb) flagellin structural gene (flaA), Mycoplasma cynos (Mcy) 16S rRNA, and Mycoplasma canis (Mca) 16S rRNA..


Table 3 . Intra- and inter-assay coefficients of variation of the triplex real-time polymerase chain reaction for Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplasma canis.

PathogenDilution (copies/reaction)Intra-assay variabilityInter-assay variability


MeanSDCV (%)MeanSDCV (%)
B. bronchisepticaHigh (106)19.320.020.1220.090.070.35
Medium (104)26.160.110.4426.800.150.55
Low (102)33.140.140.4333.680.220.66
M. cynosHigh (106)19.140.070.3618.230.060.33
Medium (104)26.060.110.4125.080.090.34
Low (102)32.330.270.8231.770.090.27
M. canisHigh (106)18.350.060.3018.040.110.59
Medium (104)25.060.140.5425.390.170.69
Low (102)32.040.090.3032.030.270.83

The mean value, standard deviation (SD), and coefficient of variation (CV) were determined based on the Ct values for the tqPCR assay..


Table 4 . Comparison of diagnostic results between the novel triplex real-time polymerase chain reaction (tqPCR) and previous qPCR assays for detecting Bordetella bronchiseptica, Mycoplasma cynos, and Mycoplasma canis.

MethodsPathogenNo. of testedNo. of positiveDetection rate (%)
New tqPCRB. bronchiseptica942122.3
M. cynos*941718.1
M. canis941920.2
Previous qPCRB. bronchiseptica942122.3
M. cynos941617.0
M. canis941920.2

*One clinical sample that tested negative for M. cynos in a previously described qPCR assay (Dong et al, 2022) was determined to be positive in the newly developed tqPCR assay with cycle threshold value of 36.8..

The positive, negative, and overall agreements between the newly developed tqPCR and previously described qPCR assays were all 100% for B. bronchiseptica and M. canis, and 94.1%, 100%, and 98.9% for M. cynos, respectively..


References

  1. Barreto ML, Lemos M, de Souza JB, de Brito SG, Alves ABP, dos Santos Machado L, Pereira VLA, Nascimento ER. 2020. Isolation and identification of Mycoplasma species in dogs. Inter J Environ & Agri Res 6:18-23.
  2. Broeders S, Huber I, Grohmann L, Berben G, Taverniers I, Mazzara M, Morisset D. 2014. Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci Technol 37:115-126.
    CrossRef
  3. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Wittwer CT. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55:611-622.
    Pubmed CrossRef
  4. Canonne AM, Peters I, Roles E, Clercx C. 2018. Detection of specific bacterial agents by quantitative PCR assays in the bronchoalveolar lavage fluid of dogs with eosinophilic bronchopneumopathy vs. dogs with chronic bronchitis and healthy dogs. Vet J 232:52-56.
    Pubmed CrossRef
  5. Chalker VJ. 2005. Canine mycoplasmas. Res Vet Sci 79:1-8.
    Pubmed CrossRef
  6. Chalker VJ and Brownlie J. 2004. Taxonomy of the canine Mollicutes by 16S rRNA gene and 16S/23S rRNA intergenic spacer region sequence comparison. Int J Syst Evol Microbiol 54:537-542.
    Pubmed CrossRef
  7. Chalker VJ, Owen WM, Paterson C, Barker E, Brooks H, Brownlie J. 2004. Mycoplasmas associated with canine infectious respiratory disease. Microbiology 150:3491-3497.
    Pubmed CrossRef
  8. Day MJ, Carey S, Clercx C, Kohn B, MarsilIo F, Thiry E, Freyburger L, Walker DJ. 2020. Aetiology of canine infectious respiratory disease complex and prevalence of its pathogens in Europe. J Comp Pathol 176:86-108.
    Pubmed KoreaMed CrossRef
  9. Decaro N, Mari V, Larocca V, Losurdo M, Lanave G, Lucente MS, Corrente M, Catella C, Bo S, Elia G, Torre G, Grandolfo E, Buonavoglia C. 2016. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease. Vet Microbiol 192:21-25.
    Pubmed KoreaMed CrossRef
  10. Dong J, Tsui WNT, Leng X, Fu J, Lohman M, Anderson J, Hamill V, Lu N, Porter EP, Gray M, Sebhatu T, Brown S, Pogranichniy R, Wang H, Bai J. 2022. Development of a three-panel multiplex real-time PCR assay for simultaneous detection of nine canine respiratory pathogens. J Microbiol Methods 199:106528.
    Pubmed CrossRef
  11. Helps CR, Lait P, Damhuis A, Björnehammar U, Bolta D, Brovida C, Chabanne L, Egberink H, Ferrand G, Fontbonne A, Pennisi MG, Gruffydd-Jones T, Gunn-Moore D, Hartmann K, Lutz H, Malandain E, Möstl K, Stengel C, Graat EA. 2005. Factors associated with upper respiratory tract disease caused by feline herpesvirus, feline calicivirus, Chlamydophila felis and Bordetella bronchiseptica in cats: experience from 218 European catteries. Vet Rec 156:669-673.
    Pubmed CrossRef
  12. Hong SH and Kim O. 2012. Molecular identification of Mycoplasma cynos from laboratory beagle dogs with respiratory disease. Lab Anim Res 28:61-66.
    Pubmed KoreaMed CrossRef
  13. Jambhekar A, Le Boedec K. 2019. A systematic review and meta-analysis of the association between 4 mycoplasma species and lower respiratory tract disease in dogs. J Vet Intern Med 33:1880-1891.
    Pubmed KoreaMed CrossRef
  14. Jinnerot T, Malm K, Wensman JJ. 2015. Development of a TaqMan real-time PCR assay for detection of Bordetella bronchiseptica. Vet Sci 1:14-20.
  15. Kim HR, Jeon GT, Kim JM, Baek JS, Shin YK, Kwon OK, Kang HE, Cho HS, Park CK. 2022. Prevalence of Bordetella bronchiseptica, Mycoplasma felis, and Chlamydia felis using a newly developed triplex real-time polymerase chain reaction assay in Korean cat population. Korean J Vet Serv 45:395-316.
    CrossRef
  16. Ko JH, Park MY, Shin BH, Nam YH, Son JI. 2020. A survey of canine infectious diseases in stray dogs in Gyeonggi Province, Korea. Korean J Vet Serv 43:217-225.
  17. Koh BRD, Kim HN, Kim HJ, Oh AR, Jung BR, Park JS, Lee JG, Kim YH. 2020. A survey of respiratory pathogens in dogs for adoption in Gwangju metropolitan city animal shelter, South Korea. Korean J Vet Serv 43:67-77.
  18. Kwiecien R, Blettner M. 2011. Concordance analysis: part 16 of a series on evaluation of scientific publications. Dtsch Arztebl Int 108:515-521.
    Pubmed KoreaMed CrossRef
  19. Lavan R and Knesl O. 2015. Prevalence of canine infectious respiratory pathogens in asymptomatic dogs presented at US animal shelters. J Small Anim Pract 56:572-576.
    Pubmed KoreaMed CrossRef
  20. Lion A, Secula A, Rançon C, Boulesteix O, Pinard A, Deslis A, Hägglund S, Salem E, Cassard H, Näslund K, Gaudino M, Moreno A, Brocchi E, Delverdier M, Zohari S, Baranowski E, Valarcher JF, Meyer G. 2021. Enhanced pathogenesis caused by influenza D virus and mycoplasma bovis coinfection in calves: a disease severity linked with overexpression of IFN-γ as a key player of the enhanced innate immune response in lungs. Microbiol Spectr 9:e0169021.
    Pubmed KoreaMed CrossRef
  21. Maboni G, Seguel M, Lorton A, Sanchez S. 2019. Canine infectious respiratory disease: New insights into the etiology and epidemiology of associated pathogens. PLoS One 14:e0215817.
    Pubmed KoreaMed CrossRef
  22. Maes D, Sibila M, Kuhnert P, Segalés J, Pieters M. 2018. Update on Mycoplasma hyopneumoniae infections in pigs: Knowledge gaps for improved disease control. Transbound Emerg Dis 65:110-124.
    Pubmed CrossRef
  23. Matsuu A, Yabuki M, Iwahana M. 2020. Molecular detection of canine respiratory pathogens between 2017 and 2018 in Japan. J Vet Med Sci 82:690-694.
    Pubmed KoreaMed CrossRef
  24. Mitchell JA, Cardwell JM, Leach H, Walker CA, Le Poder S, Decaro N, Rusvai M, Egberink H, Rottier P, Fernandez M, Fragkiadaki E, Brownlie J. 2017. European surveillance of emerging pathogens associated with canine infectious respiratory disease. Vet Microbiol 212:31-38.
    Pubmed KoreaMed CrossRef
  25. Mochizuki M, Yachi A, Ohsima T, Ishida T. 2008. Etiologic study of upper respiratory infections of household dogs. J Vet Med Sci 70:563-569.
    Pubmed CrossRef
  26. Priestnall SL, Mitchell JA, Walker CA, Brownlie J. 2014. New and emerging pathogens in canine infectious respiratory disease. Vet Pathol 51:492-504.
    Pubmed CrossRef
  27. Reagan KL and Sykes JE. 2020. Canine infectious respiratory disease. Vet Clin North Am Small Anim Pract 50:405-418.
    Pubmed KoreaMed CrossRef
  28. Scholten SS, Tozon N, Koprivec S, Florjancic M. 2017. Molecular detection and seroprevalence of mycoplasmas in clinically healthy working dogs. Slovenian Vet Res 54:155-161.
    CrossRef
  29. Schulz BS, Kurz S, Weber K, Hartmann K. 2014. Detection of respiratory viruses and Bordetella bronchiseptica in dogs with acute respiratory tract infections. Vet J 201:365-369.
    Pubmed KoreaMed CrossRef
  30. Sowman HR, Dunowska M. 2018. A survey of canine respiratory pathogens in New Zealand dogs. N Z Vet J 66:236-242.
    Pubmed CrossRef
  31. Spergser J and Rosengarten R. 2007. Identification and differentiation of canine Mycoplasma isolates by 16S-23S rDNA PCR-RFLP. Vet Microbiol 125:170-174.
    Pubmed CrossRef
  32. Tallmadge RL, Anderson R, Mitchell PK, Forbes ZC, Werner B, Gioia G, Moroni P, Glaser A, Goodman LB. 2020. Characterization of a novel Mycoplasma cynos real-time PCR assay. J Vet Diagn Invest 32:793-801.
    Pubmed KoreaMed CrossRef
  33. Tizolova A, Brun D, Guillot S. 2014. Development of real-time PCR assay for differential detection of Bordetella bronchiseptica and Bordetella parapertussis. Diagn Microbiol Infect Dis 78:347-351.
    Pubmed CrossRef
  34. Windsor RC, Johnson LR, Sykes JE, Drazenovich TL, De Cock HE. 2006. Molecular detection of microbes in nasal tissue of dogs with idiopathic lymphoplasmacytic rhinitis. J Vet Intern Med 20:250-256.
    Pubmed CrossRef
KJVS
Dec 30, 2023 Vol.46 No.4, pp. 255~368

Stats or Metrics

Share this article on

  • line

Related articles in KJVS

Korean Journal of
Veterinary Service

eISSN 2287-7630
pISSN 1225-6552
qr-code Download