Korean Journal of
Veterinary Service

Influenza viruses, belonging to the family Orthomyxoviridae, are enveloped viruses with segmented negative-sense RNA genome (Van Reeth and Vincent, 2019). Influenza A viruses evolve rapidly, creating new variants which could be the result of either point mutations or reassortment. Eighteen hemagglutinin (HA) and 11 neuraminidase (NA) types have been reported to date, classifying viruses into subtypes H1 to H18 and N1 to N11 (Tong et al, 2013).

Influenza viruses have been isolated from a number of different animal hosts including birds, humans, horses, whales, minks, and pigs. Generally, influenza viruses are host specific and viruses from one host rarely establish stable lineages in another host species. Although whole viruses may rarely transmit, gene segments can cross the species barrier through the process of genetic reassortment. Pigs have been postulated to play an important role in the process of genetic reassortment by acting as the “mixing vessel” for such events (Scholtissek, 1990).

Swine influenza (SI) is an acute respiratory disease whose severity depends on many factors including pig age, virus strain, and secondary infections (Van Reeth and Vincent, 2019). Currently three main subtypes of influenza virus are circulating in different swine populations throughout the world: H1N1, H3N2, and H1N2. Swine influenza virus (SIV) (H3N2) was derived from several viruses circulating in swine, and the initial transmission to humans occurred several months before recognition of the outbreak (Noh et al, 2020).

While cases of human infection with swine influenza A virus variant have been reported in the United States recently, and H3N2 mutants have also been periodically isolated from pigs in Korea since 2011 (Noh et al, 2020). In this study, we isolated H3N2 influenza A virus from Korean pig farms, and elucidated its molecular properties through next generation sequencing.

Isolation of SIV and RNA extraction

Three nasal swab samples were collected from grow-finish swine with symptoms of respiratory disease from a swine farm located in Chungnam province, Korea. 2021. H3N2 SIV was isolated in 10-day-old embryonated specific-pathogen-free (SPF) chicken eggs (Valo, USA), and 3 days later, the allantoic fluid was collected. To determine the genomic sequences of the isolated virus, the viral RNAs of egg-grown samples were extracted using a QIAamp^® Viral RNA Mini Kit (Qiagen Co., Hilden, Germany) according to manufacturer’s instructions. Briefly, lyophilized carrier RNA was combined with AVE buffer solution and then mixed with AVL buffer by 1:10 ratio. Then, the sample was added to the AVL buffer which contains carrier RNA. After incubating at room temperature for 10 minutes, the sample mixture was added by ethanol (96∼100%) and mixed by pulse-vortexing for 15 seconds. And it was transferred to QIAmp Mini columns and centrifuged at 6,000×g for 1 minutes. After adding AW1 and AW2, it was centrifuged at 6,000×g and 20,000×g, respectively. Then, 1 minute after adding 50 mL of AVE buffer, RNA was extracted by centrifugation at 6,000×g for 1 minute. The extracted RNA was stored at −80℃.

Multi-segment RT-PCR

A total of 8 segments of viral RNA were amplified by using multi-segment RT-PCR method suggested by Zhou et al (2009), which can produce whole-genome sequences of influenza virus even faster than conventional Sanger sequencing method. Universal primers (i.e., Uni12/inf-1 (forward): GGGGGGAGCAAAAGCAGG; Uni13/inf-1 (reverse): CGGGTTATTAGTAGAAACAAGG), reported by Zhou et al (2009) were used in this study. Multiplex RT-PCR amplicons were generated by the SuperScript™ III One-Step RT-PCR System with Platinum™ Taq High Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA). PCR products were purified using Agencourt AMPure XP (Beckman Coulter, Brea, CA, USA) according to the manufacturer’s instructions.

Library preparation

Using the multiplex RT-PCR amplicon, the complete influenza virus genome was analyzed via Illumina iSeq 100™ (Illumina, CA, USA). In order to prepare the paired-end DNA libraries for iSeq platform, Nextera™ DNA Flex Library Prep Kit (Illumina) and Nextera™ DNA CD Indexes (Illumina, CA, USA) were used. DNA libraries were analyzed using the Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA) with an Agilent DNA 7500 Kit (Agilent Technologies, CA, USA).

Next generation sequencing

Sequencing was performed using a 300-cycle (2×150-bp paired-end) iSeq v2 reagent kit (Illumina, CA, USA) on the iSeq platform following the manufacturer’s instruction. The sequence run parameters, sample information, and index information were created using local run manager on the iSeq 100 (Illumina, CA, USA). We thawed iSeq 100 reagent cartridges (Illumina, CA, USA) at room temperature overnight, and we incubated flow cells at room temperature for 15 minutes prior to loading them onto the cartridge. To prepare the pooled libraries for sequencing, approximately 5% of PhiX sequencing controls were added. After loading the cartridge with 20 ul of each of the pooled 200 pM libraries and the phix control, the flow cell was inserted into the slot on the front of the cartridge and then the cartridge was inserted into the iSeq 100 (Illumina, CA, USA). Sequencing was run for an approximately 17 hours with 301 cycles, using pair-end sequencing of 2×150 bp reads.

Bioinformatics

The results of the sequencing run were analyzed using Illumina’s Sequencing Analysis Viewer version 2.4.7. Raw reads with adaptor and index sequences were trimmed with Trim Galore (V0.6.1), Cutadapt (V2.2) (Turner et al, 2017), and low quality sequences were filtered with Flexbar FASTQ read trimmer (V1.4.0) (Cabanski et al, 2014). Quality of trimmed sequence data were assessed by use of FastQC (V0.11.9) (Cabanski et al, 2014). The De Novo assembly of raw reads was performed using CLC genomic Workbench (Graham et al, 2014). Raw reads were also mapped in CLC genomic Workbench to the reference influenza genomes. The resulting contigs from the De Novo assembly were aligned to reference genes for each segment using BioEdit program. The full-length nucleotide sequences of swine influenza A viruses registered with NCBI were used as references in the phylogenetic analysis. MEGA5 was used to analyze the phylogenetic tree and molecular evolutionary genetics analysis. The genetic distances were determined with MEGA5 by the neighbor-joining method using bootstrap estimation (1,000 replicates).

From the whole genome sequencing results using NGS system, 832,132 reads were produced with an average of 97% classified influenza reads after quality check and removing low quality reads. The influenza A virus sequences were automatically generated for each multi-segment amplicon by using a de novo assembly or mapping program in CLC genomic workbench, and 8-9 contigs based on high coverage rates of sequence reads were generated. A high coverage was generated by the sequencing protocol for each sample, with an average coverage of 9,372.12x for each genomic segment. The genome sequence of the influenza A virus strain A/swine/Korea/21810/2021 (sw21810), isolated from swine in the Republic of Korea. On the basis of sequence analysis, A/swine/Korea/21810/2021 is marked from swine H3N2 influenza virus.

The quality of sequencing was high for the majority of the genomic segment, however, two segments presented low coverage for the polymerase acidic (PA) and polymerase basic two (PB2) genes. A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to identify sequences closest to those of previously isolated H3N2 influenza viruses (Table 1). The 4 contigs were found to correspond to PB2, PB1 (polymerase basic one), NP (nucleoprotein) and NA (neuraminidase) A/Swine/Korea/CY03-19/2012 with 96∼97% sequence identity. PA and HA genes were closely related to that A/Swine/Korea/KSB/2012 (H1N2) with 97.18% homology, and that of a A/Swine/Manitoba/D0195/2013 (H3N2) with 94.76% homology, respectively. M (matrix) and NS (non-structural protein) genes of a A/Swine/Korea/21810/H3N2 were closely related to that A/Swine/Korea/KS60/2016 (H1N2) with 98.50% homology, and that of a A/Swine/Korea/CY03-16/2012 (H3N2) with 100% homology, respectively.

Table 1 . Nucleotide homology of genes of influenza virus strain A/swine/Korea/21810/2021(H3N2) to the closest influenza virus strains in GenBank.

Gene	Closest related influenza a virus strain	Query coverage (%)	Sequence identity (%)	Genbank accession No.
PB2	A/Puerto Rico/8/1934 x A/Indiana/10/2011) (H3N2)_reassortant	100%	96.90%	KJ942703.1
PB1	A/Indiana/21/2012 (H3N2)	100%	96.52%	KJ942694.1
PA	A/swine/Korea/CY0423-12/2013 (H1N2)	100%	97.18%	KF142494.2
HA	A/swine/Manitoba/D0195/2013 (H3N2)	98%	94.76%	CY194509.1
NP	A/swine/Ohio/11SW233/2011 (mixed)	98%	97.76%	KF203223.1
NA	A/Indiana/10/2011 (H3N2)	99%	97.53%	KJ942594.1
M	A/swine/South Korea/KS60/2016 (H1N2)	99%	98.50%	MH844911.1
NS	A/swine/Korea/CY03-16/2012 (H3N2)	100%	100.00%	JX398003.1

Phylogenetic trees were constructed for each segment of influenza genomes analyzed using the Tamura 2-parameter model. In phylogenetic analysis of the polymerase genes, and the PB2 and PB1 segments of isolate was grouped with that of the Triple reassortant Swine H3N2 origin virus (Fig. 1A, 1B). On the other hand, PA segment of isolate belonged to 2009 Pandemic H1N1 origin lineage (Fig. 1C). Meanwhile, the HA segment was closely related to that of isolates from cluster I (Fig. 2A) and NA segment of the isolate belonged to a Korean Swine H1N1 origin (Fig. 2B). The NP and NS segments of the isolate were grouped with that of the Triple reassortant Swine H3N2 origin virus (Fig. 3A, 3B) and the M segment of the isolate belonged to 2009 Pandemic H1N1 origin lineage (Fig. 3C).

Figure 1. Phylogenetic tree of polymerase segments. The evolutionary phases of the PB2 (A), PB1 (B), and PA (C) segments of A/swine/Korea/21810/2021 (H3N2) (sw21810) virus was inferred with those of NCBI-registered reference sequences by the ML method using MEGA5.

Figure 2. The phylogenetic relationships of surface glycoprotein segments. The evolutionary phases of the HA (A) and NA (B) segments of A/swine/Korea/21810/2021 (H3N2) (sw21810) virus was inferred with those of NCBI-registered reference sequences by the ML method using MEGA5.

Figure 3. The phylogenetic relationships of NP, M, and NS segments. The evolutionary phases of the NP (A), NS (B), and M (C) segments of A/swine/Korea/21810/2021 (H3N2) (sw21810) virus was inferred with those of NCBI-registered reference sequences by the ML method using MEGA5.

Our results demonstrate the genetic diversity of the swine H3N2 viruses circulating in Korea and the necessity of epidemiological preparedness through comprehensive surveillance. Recently, H3N2v viruses were also identified in pigs on Korean farms (Kim et al, 2013; Kim et al, 2014; Noh et al, 2020). When considering that various avian, swine, and human IAVs can infect pigs (Trebbien et al, 2013), swine-origin novel IAV variants in Korea may pose serious threats to local and global communities.

Meanwhile, SIV infection has been continuously increasing in Korean pig farms, but SIV detection and molecular epidemiologic analysis have not been performed efficiently. Most of all, in molecular epidemiological research of swine influenza, SIV isolation must be preceded for viral genome sequencing. In cases where a large amount of SIV cannot be obtained from a sample or isolates a SIV from an environmental sample, whole genome sequencing methods is a solution to this problem in various ways including enrichment step (Tindale et al, 2020).

While cases of human infection with swine influenza A virus variant have been reported in the United States recently, and H3N2 mutants have also been periodically isolated from pigs in Korea since 2011 (Noh et al, 2020). In this study, we isolated H3N2 influenza A virus from Korean pig farms, and elucidated its molecular properties through next generation sequencing. Our results suggest the need for periodic close monitoring of this novel swine H3N2 influenza virus from a public health perspective.

This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through Animal Disease Management Technology Development Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (321008-1).

No potential conflict of interest relevant to this article was reported.