Korean Journal of
Veterinary Service

Porcine circovirus (PCV) is a non-enveloped small DNA virus containing a single covalently closed, circular, single-stranded DNA genome, which belongs to the genus Circovirus of the family Circoviridae (Rosario et al, 2017). To date, four species of PCVs have been identified to infect pigs, including PCV1, PCV2, PCV3, and PCV4. PCV4, a novel genetically distinct PCV was newly discovered in 2019 from Chinese pig farms suffering from PDNS-like clinical syndrome in the Hunan province of China (Zhang et al, 2020b). PCV4 infection was further confirmed in diseased or healthy pigs in other provinces in China (Zhang et al, 2020a; Sun et al, 2021; Tian et al, 2021) as well as in Korea (Nguyen et al, 2021; Kim et al, 2022). Since the novel PCV4 is difficult to isolate from in vitro cell culture, molecular diagnostic assays such as conventional polymerase chain reaction (cPCR) (Ha et al, 2021; Tian et al, 2021), SYBR Green-based real-time PCR (qPCR) (Zhang et al, 2020a; Hou et al, 2021), and TaqMan probe-based qPCR (Zhang et al, 2020b; Chen et al, 2021), are currently used for the detection of PCV4 from clinical samples. The SYBR Green-based qPCR assay is used to monitor the amplification of the target gene using SYBR Green I, which binds to the minor groove of the double-stranded DNA (dsDNA) and emits fluorescence 1,000-fold greater fluorescence than that in free solution (Tajadini et al, 2014). Therefore, a higher amount of dsDNA in the reaction tube results in an increased amount of bound dye, which thereby increases the fluorescence signal. However, the specificity of the assay is the most important concern with the usage of any of these non-specific dsDNA-binding dyes. Non-specific products are reflected in the dissociation curve of the amplified product as non-specific peaks. SYBR Green is relatively cost efficient, but it is non-specific. The SYBR Green-based qPCR assay for PCV4 developed by Zhang et al (2020a) generated non-specific fluorescence signals with other viral samples, including the porcine epidemic diarrhea virus and pseudorabies virus. Therefore, TaqMan probe-based qPCR assay is more reliable for the detection of PCV4 from clinical samples as it prevents non-specific fluorescence signals caused by the use of target-specific TaqMan probe for monitoring the results. Recently, two TaqMan probe-based qPCR assays have been described for pcv4 detection in previous studies (Zhang et al, 2020b; Chen et al, 2021). However, these early developed assays used a primers/probe set that was designed based on a limited number of PCV4 sequences (only one or two PCV4 sequences, respectively) that were available in GenBank when the assay was developed.Therefore, it is needed to design a new primers/probe set for improving their strain coverage and diagnostic sensitivity using more available PCV4 sequences. Moreover, these assays did not use internal positive control (IPC) to avoid false-negative results.

The present study, we developed a duplex TaqMan probe-based qPCR assay with IPC for the detection of PCV4 in clinical samples. Such an assay will allow a more accurate and reliable diagnosis of PCV4 in suspected clinical cases and will lead to further etiological and epidemiological studies and control of the PCV4 infection.

Viruses and samples

PCV2 (PCK0201 strain) (Park et al, 2004), PCV3 (PCK3-1701 strain) (Kim et al, 2017), and PCV4 (PCV4-K2101 strain) (Kim et al, 2022) Korean field strains were used to optimize the dqPCR conditions in this study. Other porcine viral pathogens, including PCV1 (positive PK-15 cell culture), type 1 porcine reproductive and respiratory syndrome virus (PRRSV, Lelystad virus), type 2 PRRSV (LMY strain), classical swine fever virus (LOM strain), and porcine parvovirus (NADL-2 strain) were obtained from the Animal and Plant Quarantine Agency or Animal Disease Intervention Center for conducting the specificity test of the assay (Table 1). Two porcine-origin cell cultures not infected with PCV4 (ST cells and PK-15 cells) were used as negative controls. All pathogen samples were allocated and stored at −80℃ until use. For clinical evaluation of the dqPCR, 102 samples (78 sera, 17 tissues, and 7 oral fluids) were collected from 18 PCV4-infected pig farms, and PCV4 infections were confirmed using a previously described qPCR assay (Zhang et al, 2020b). The tissue samples were homogenized and diluted 10-fold with phosphate-buffered saline (0.1 M, pH 7.4). The tissue and oral fluid samples were centrifuged at 10,000×g for 10 min to obtain the supernatant. All supernatants were aliquoted and stored at −80℃ for further genetic analysis. Nucleic acids were extracted from 200 μL of a virus stock and field samples, using the TAN Bead Nucleic Acid Extraction kit for automated extraction (TAN Bead, Taiwan) according to the manufacturer’s protocol, and were stored at −80℃.

Table 1 . Specificity of duplex real-time PCR assay using PCV4 or IPC-specific primers and probe set.

Pathogen	Strain	Sourcea	Amplification of target gene
			PCV4 (FAM)	IPC (HEX)b
PCV1	PK-15 cell culture	ADIC	−	+
PCV2	PCK0201	ADIC	−	+
PCV3	PCK3-1701	ADIC	−	+
PCV4	PCV4-K2101	ADIC	+	−
PCV4-positive tissue	-	ADIC	+	+
PCV4-positive serum	-	ADIC	+	+
PCV4-positive saliva	-	ADIC	+	+
PCV4-negative tissue	-	ADIC	−	+
PCV4-negative serum	-	ADIC	−	+
PCV4-negative saliva	-	ADIC	−	+
PRRS virus, genotype 1	Lelystad virus	APQA	−	−
PRRS virus, genotype 2	LMY strain	APQA	−	−
Classical swine fever virus	LOM strain	APQA	−	+
Porcine parvovirus	NADL-2	APQA	−	+
ST cell	-	ADIC	−	+
PK-15 cell	-	ADIC	−	+

^aAPQA, Animal and Plant Quarantine Agency, Korea; ADIC, Animal Disease Intervention Center, Kyungpook National University, Korea; +, positive reaction; −, negative reaction..

^bHEX fluorescence signals were obtained from all viruses, clinical pig samples and swine-origin cells except PCV4 standard DNA and two PRRSVs cultured in non-porcine origin line cells (MARC-145 cells)..

Reference gene construction

The complete replicase (Rep) and capsid (Cap) genes of PCV4 was amplified by PCR from a Korean field isolate (PCK4-2021 strain, GenBank accession number MZ436811) using a pair of specific primers (PCV4-22F 5’-CACACTTCGGCACAATCGAG-3’ and PCV4-1741R 5’- ACCCACAGATGCCAATCAGA-3’). PCR was performed using a commercial kit (PrimeSTAR^® GXL DNA Polymerase; Takara, Shiga, Japan) in 50-μL reaction mixtures containing 10 μL of 5× PrimeSTAR GXL Buffer, 4 μL of dNTP mixture, 1 μL of PrimeSTAR GXL DNA Polymerase, 0.2 μM of each primer, and 5 μL of PCV4 DNA as template, according to the manufacturer’s instruction. Amplification was conducted using a thermal cycler (Applied Biosystems, USA) under the following conditions: initial denaturation at 98℃ for 1 min; 35 cycles of amplification (10 s at 98℃, 15 s at 55℃, and 2 min at 68℃), and a final extension at 68℃ for 7 min. The amplified product was cloned into the pTOP TA V2 vector (TOPcloner™ TA core kit; Enzynomics, Korea) as previously described (Kim et al, 2017). Plasmids containing the PCV4 capsid gene were purified using a commercial kit (GeneAll Expin™ Combo GP 200 miniprep kit, GeneAll, Seoul, Korea). The concentration of each plasmid sample was determined by measuring the absorbance at 260 nm using a NanoDrop Lite (Thermo Scientific, Waltham, MA, USA), and the copy numbers of each cloned gene were quantified as previously described (Kim et al, 2017). Ten-fold serial dilutions of the PCV4 standard DNA sample (10⁶-10⁰ copies/μL) were stored at −80℃ and used as standards for PCV4 quantitation of diagnostic samples.

Primers and probes for the dqPCR assay

Primers and probe for PCV4 were newly designed using the Primer Express software (version 3.0) (Applied Biosystems, USA) based on a total of 49 PCV4 genome sequences available in the National Center for Biotechnology Information (NCBI) at the time of design. A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to check the specificity of the primers and probe. Each primer and probe sequence for PCV4 used in this study showed 100% homology with the corresponding sequences of the virus. For real-time monitoring of the qPCR amplification, the probe for the capsid gene was labeled with a 6-carboxyfluorescein (FAM) reporter dye at the 5’ end and Black Hole Quencher 1 (BHQ1) at the 3’ end, according to the manufacturer’s instructions (BIONICS, Daejeon, Korea) (Table 2). To avoid false-negative results, the porcine house-keeping gene, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as a marker for the presence of porcine cellular materials and as an endogenous internal positive control (IPC). The GAPDH-specific primers/probe set was adopted from a previous report (Duvigneau et al, 2005). For the accurate differential detection of PCV4 and IPC using the dqPCR, it is essential that the sequence-specific probes are labeled with reporter dyes whose fluorescence spectra are distinct or show only minimal overlap (Navaro et al, 2015). In the present study, for the simultaneous and differential detection of the capsid gene of PCV4 and IPC in a single reaction, probes for the capsid genes were differently labeled at the 5’ and 3’ ends with FAM and BHQ1 for PCV4, and 6-carboxy-2’,4,4’,5’,7,7’-hexachlorofluorescein (HEX) and BHQ1 for IPC according to the manufacturer’s guidelines (BIONICS, Daejeon, Korea) (Table 2).

Table 2 . Primers and probes used in this study.

Assay	Primer/probe	Sequence (5’-3’)	Genome position	Genes	Amplicon (bp)	Reference
dqPCR	Forward	TAGTGGCAGAAATTCGACTT	1425∼1444	ORF2	100	In the present study
	Reverse	GGACTTTATCCCAAAAGGAC	1505∼1524
	Probe	FAM-CCGGTAATATGCAAATGGGAGGCTG-BHQ1	1458∼1482
TaqMan probe qPCR	Forward	GCAGTAATGACGTAGTCCCGGAG	504∼526	ORF1	123	Zhang et al (2020b)
	Reverse	CAGCGACCTTAAAGCGGCTGTG	404∼425
	Probe	FAM-CCGCCCTGAATGCCGGCAGCTCAATG-BHQ1	427∼452
SYBR green qPCR	Forward	CTGGAAGTGGAGGGTGT	1221∼1237	ORF2	119	Zhang et al (2020a)
	Reverse	ATGATGTCCTGGCAAAC	1323∼1339
cPCR	Forward	GTTTTTCCCTTCCCCCACATAG	1347∼1368	ORF2	391	Tian et al (2021)
	Reverse	ACAGATGCCAATCAGATCTAGGT	1715∼1737
IPC qPCR	Forward	ACATGGCCTCCAAGGAGTAAGA	1083∼1104	GAPDH	106	Duvigneau et al (2005)
	Reverse	GATCGAGTTGGGGCTGTGACT	1168∼1188
	Probe	HEX-CCACCAACCCCAGCAAGAGCACGC-BHQ1	1114∼1137

Genome position of primer- and probe-binding sequences according to the complete genome sequence of PCV4 HNU-AHG1-2019 strain and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) (GenBank accession no. MK986820 and NM_001206359, respectively)..

Optimization of the qPCR assay conditions

Before optimization of the dqPCR, a monoplex qPCR assay with each PCV4 or IPC primer and probe set was performed using a commercial qPCR kit (RealHelix™ qPCR kit probe, NanoHelix, Daejeon, Korea) and CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The 20-μL reaction mixture contained 10 μL of 2× Premix buffer with enzyme, 0.25 μM of each primer, 0.2 μM probe, and 5 μL PCV4 standard DNA, and it was prepared according to the manufacturer’s instructions. To optimize the dqPCR conditions, the concentrations of the two sets of primers and probe were optimized, whereas the other reaction components were the same as those used for monoplex qPCR. The dqPCR programs were the same with the following conditions: initial denaturation at 95℃ for 15 min, followed by 40 cycles at 95℃ for 20 s, and 60℃ for 40 s. The cycle threshold (Ct) values from the FAM (PCV4 Cap gene) and HEX (IPC) fluorescence signals were obtained for every sample at the end of each annealing step. To interpret the qPCR results, samples producing a Ct<40 were considered positive. When no Ct values were observed during the 40 amplification cycles, the sample was considered negative. To confirm the interference in amplification and detection between target PCV4 DNA and IPC, the dqPCR assay was performed with nucleic acids extracted by spiking PCV4 standard DNA (10-fold dilutions) into serum, tissue, and saliva samples.

Specificity and sensitivity of the qPCR assay

To test the specificity of the qPCR assay, the assay was performed using total nucleic acids extracted from seven viral samples (PCV1, PCV2, PCV3, type 1 and 2 PRRSV, classical swine fever virus, and porcine parvovirus), one standard DNA sample for PCV4, and two porcine-origin cell cultures (ST cell and PK-15 cell) as negative controls. The sensitivity of dqPCR for PCV4 DNA was determined in triplicates using serial dilutions (10⁶-10⁰ copies/μL) of each plasmid DNA containing the PCV4 Rep and Cap genes. Subsequently, the limit of detection (LOD) of the dqPCR assay was compared with that of the cPCR (Tian et al, 2021), TaqMan probe-based qPCR (Zhang et al, 2020a), and SYBR Green-based qPCR (Zhang et al, 2020b) using the same DNA templates. For data analysis, CFX96 Touch™ Real-Time PCR Detection software (Bio-Rad) was used to create a standard curve with the threshold cycle (Ct) values of the 10-fold dilutions of PCV4 capsid DNA (10⁶-10⁰ copies/μL). Further, the detection software was used to calculate the correlation coefficient (R²) of the standard curve, standard deviations of the results, and PCV4 DNA copy number of the samples based on the standard curve.

cPCR and qPCR assays for comparative analysis

The cPCR and qPCR assays were performed as previously described with some modification (Zhang et al, 2020a; Zhang et al, 2020b; Tian et al, 2021). The primers used in these assays are shown in Table 2. The cPCR assay for PCV4 was performed with the Cap gene-specific primers (Tian et al, 2021) using a commercial PCR kit (Excel TB 2X Taq premix; Inclone, Korea) and amplification was conducted using a thermal cycler (Applied Biosystems, USA), according to the manufacturer’s instructions. The expected 391-bp amplicons were visualized using an UV transilluminator (Bio-Rad, USA) after 1.5% agarose gel electrophoresis and staining with NEO green dye (Neoscience, Korea). The SYBR Green-based qPCR assay for PCV4 was performed with the Cap gene-specific primers (Zhang et al, 2020a) a commercial qPCR kit (TB Green^® Premix Ex Taq™ [Tli RNaseH Plus], Takara, Shiga, Japan) and amplification was conducted using a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA), as per the manufacturer’s instructions. Melting curve analysis was performed by monitoring the fluorescence of the SYBR Green signal from 65℃ to 95℃ with an increment of 0.5℃. When interpreting the qPCR results, samples producing Ct values of <35 and those with specific melting peaks at 84.0℃±0.5℃ were considered positive, as per a previous study (Zhang et al, 2020a). The TaqMan probe-based qPCR assay for PCV4 was performed with the Rep gene-specific primers (Zhang et al, 2020b) using the same commercial qPCR kit as dqPCR, and amplification was conducted using carried out using a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA), according to the manufacturer’s instructions. When interpreting the qPCR results, samples were considered negative when a signal was detected with a Ct value>39 (Zhang et al, 2020b).

Precision of the dqPCR assay

Repeatability (intra-assay precision) and reproducibility (inter-assay precision) of the dqPCR assay for PCV4 were determined using three different concentrations (high, medium, and low) of each viral standard gene tested. The concentrations of capsid genes of PCV4 were 10⁶, 10⁴, and 10² copies/μL. For intra-assay variability, each dilution was analyzed in triplicate on the same day, whereas for inter-assay variability, each dilution was analyzed in six independent experiments performed by two different operators on different days as per the MIQE guidelines (Bustin et al, 2009). The coefficient of variation (CV) for the Ct values was determined based on the intra-assay or inter-assay results and expressed as a percentage of the mean value together with the and standard deviation values.

Clinical evaluation of the dqPCR assay

For clinical evaluation of the qPCR assay, 102 clinical samples (78 sera, 17 tissues, and 7 saliva samples) were collected from 18 pig farms in 2020 and tested using the newly developed dqPCR assay. Samples were considered as positive if both fluorescence signals of PCV4 and IPC were detected, negative if the internal control was amplified but not the Cap gene, and invalid if the internal control was not amplified. The qPCR results were compared with that of the TaqMan probe-based qPCR (Zhang et al, 2020b), SYBR Green-based qPCR (Zhang et al, 2020a), and conventional PCR (cPCR). Further, the inter-assay concordance was analyzed using Cohen’s kappa statistics at a 95% confidence interval (CI) (Kwiecien et al, 2011). When the calculated kappa coefficient value (κ) was interpreted as κ<0.20=slight agreement, 0.21∼0.40=fair agreement, 0.41∼0.60=moderate agreement, 0.61∼0.80=substantial agreement, and 0.81∼ 1.0=almost perfect agreement (Kwiecien et al, 2011).

Interpretation of the dqPCR assay

The fluorescent signals of FAM and HEX were detected for PCV4 and IPC using dqPCR, respectively. The results of dqPCR using the optimized primer concentration (0.25 µM each primer and 0.2 µM of each probe for PCV4 and IPC, respectively) showed that two fluorescent signals of FAM and HEX could be simultaneously detected using the dqPCR assay. In addition, it was confirmed that IPC primers/probes were consistently detected for each sample type regardless of the concentration of PCV4 standard DNA (Fig. 1). These results demonstrated that dqPCR could successfully amplify the two target genes of PCV4 and GAPDH in clinical samples in a single reaction without spurious amplification or significant cross-reactivity between the two fluorescent dyes (Fig. 1).

Figure 1. The limit of detection (LOD) and standard curve of duplex real-time polymerase chain reaction (dqPCR) in the presence of serum, tissue, and saliva. (A, C, E) LOD of dqPCR for serial 10-fold dilutions of PCV4 standard DNA spiked into pig samples of serum, tissue, and saliva, respectively. Lines 6∼ 0, 10-fold serial dilutions of the PCV4 standard DNA (5 × 10⁶–10⁰ copies). (B, D, F) Standard curve for dqPCR using serial 10-fold dilutions of PCV4 standard DNA (5×10⁶–10⁰ copies) spiked into pig samples of serum, tissue, and saliva were plotted against the threshold cycle on (Ct). The coefficient of determination (R²) and the equation of the regression curve (y) were calculated using the CFX Manager Software (Bio-Rad).

Specificity and sensitivity of the dqPCR assay

The primer and probe set for PCV4 of dqPCR assay detected the PCV4 virus DNA and standard DNA, and no positive results were obtained for any of the other swine pathogens and two swine-origin cell cultures (Table 1). IPC primer and probe set detected all viruses, clinical pig samples and swine-origin cells except PCV4 standard DNA and two PRRSVs cultured in non-porcine origin MARC-14 cells. The LOD of dqPCR was below 5 gene copies for PCV4, which was 10-fold lower than that of a previously described Zhang’s SYBR Green-based qPCR and Zhang’s TaqMan probe-based qPCR. However, the LOD of the dqPCR assay was 100-fold lower than that of the Tian’s cPCR assay (Fig. 2). To determine the linearity of the reaction and PCR efficiency, standard curves for the target genes were generated by plotting their Ct numbers versus their dilution factors. The dqPCR assay revealed high correlation values (R²>0.99) between the Ct values, and the dilution factors were calculated for the dqPCR assays (Fig. 2).

Figure 2. Comparison of sensitivities of a duplex real-time polymerase chain reaction (dqPCR) among Zhang’s TaqMan probe-based real-time polymerase chain reaction (qPCR), Zhang’s SYBR Green-based real-time polymerase chain reaction (qPCR), and Tian’s conventional polymerase chain reaction (cPCR). The limit of detections (LOD) and standard curve of the dqPCR (A, B), LOD and melting curve of the Zhang’s SYBR Green-based qPCR (C, D), and LOD of the Zhang’s TaqMan probe-based qPCR and Tian’s cPCR (E, F). Lines 6-0, 10-fold serial dilutions of the PCV4 standard DNA (5×10⁶−10⁰ copies); NC, negative control.

Precision of the dqPCR assay

To assess the intra-assay repeatability and inter-assay reproducibility, three different concentrations (high, medium, and low) of PCV4 standard DNA were tested in triplicates in six different runs performed by two operators on different days. The coefficients of variation within runs (intra-assay variability) ranged from 0.27% to 0.45%. The inter-assay variability ranged from 0.40% to 0.72% (Table 3). These results indicated that the dqPCR assay developed in this study can be used as an accurate and reliable diagnostic tool for PCV4.

Table 3 . Intra- and inter-assay coefficient of variation of duplex quantitative real-time PCR (qPCR).

Dilution (copies/µL)	Porcine circovirus 4
	Intra-assay				Inter-assay
	Mean	SD	CV (%)		Mean	SD	CV (%)
High (106)	17.45	0.12	0.27		17.79	0.28	0.4
Medium (104)	24.68	0.04	0.35		24.54	0.22	0.65
Low (102)	32.02	0.13	0.45		31.4	0.65	0.72

The mean value, standard deviation (SD), and coefficient of variation (CV) were determined based on the Ct values for dqPCR..

Comparative clinical evaluation of the dqPCR assay

The dqPCR assay detected 27 of 102 clinical samples as PCV4-positive, and IPC was successfully amplified using dqPCR assay in all clinical samples, indicating that the results of the assay could be interpreted as valid. The clinical test of the dqPCR assay was equivalent to that of PCV4 monoplex qPCR, and the results of clinical evaluation for dqPCR were compared with that for the three previous assays (Table 4). The detection rates of PCV4 in dqPCR, Zhang’s SYBR Green-based qPCR, Zhang’s TaqMan probe-based qPCR, and Tian’s cPCR were 26.5% (27/102), 26.5% (27/102), 21.6% (22/102), and 17.6% (18/102), respectively (Table 4). Regarding the detection of PCV4 DNA from the clinical samples, the percentage of positive, negative, and overall agreement among the results of the dqPCR and Zhang’s SYBR Green-based qPCR, Zhang’s TaqMan probe-based qPCR, or Tian’s cPCR was 96.3% (26/27), 98.7% (74/75), 98.0% (100/102); 81.5% (22/27), 100.0% (75/75), 95.1% (97/102); 66.7% (18/27), 100.0% (75/75), 91.2% (93/102); respectively. The kappa values (95% CI) were 0.95 (0.88∼ 1.02), 0.87 (0.75∼0.98), and 0.75 (0.59∼0.90). This indicated that the diagnostic results between dqPCR and Zhang’s SYBR Green-based qPCR or Zhang’s TaqMan probe-based qPCR were approximately 100% concordant and those between dqPCR and Tian’s cPCR showed substantial agreement. When comparing the results obtained using dqPCR and Zhang’s SYBR Green-based qPCR assay, there were two discordant samples. They included a dqPCR-positive and Zhang’s SYBR Green-based qPCR-negative tissue sample and one dqPCR-negative and Zhang’s SYBR Green-based qPCR-positive saliva sample. For the one discordant saliva sample (Ct value=34.86) that was dqPCR-negative and Zhang’s SYBR Green-based qPCR-positive, the specific melting peaks at 84.0℃±0.5℃ was not detected and this result could be determined as there was a non-specific amplification. In addition, the dqPCR assay detected five more PCV4 serum samples compared with the clinical evaluation results of Zhang’s TaqMan probe-based qPCR. The dqPCR assay further detected PCV4 from nine clinical samples (four saliva samples, three tissues, two sera) that were Tian’s cPCR-negative. For these samples with additional detection discordances that were obtained after amplification using dqPCR, the DNA sequences of dqPCR amplicons were further analyzed using PCV4F and PCV4R primers via Sanger’s sequencing by a commercial company (BIONICS, Daejeon, Korea). And, we have confirmed that all nucleotide sequence fragments over 100bp are PCV4 specific Cap genes, indicating that the dqPCR-positive results are true positives, not false positives. Furthermore, the dqPCR assay successfully amplified the GAPDH gene in all dqPCR-positive-mismatched samples.

Table 4 . Comparison of diagnostic results of clinical samples between duplex quantitative real-time PCR (dqPCR) and previously reported qPCR assays for PCV4 detection.

Test results of different assays		New dqPCR			Detection rate	Overall percent agreement
		Positive	Negative	Total
Zhang’s SYBR Green-based qPCR	Positive	26	1	27	26.5%	98.0%
	Negative	1	74	75
	Total	27	75	102
Zhang’s TaqMan probe-based qPCR	Positive	22	0	22	21.6%	95.1%
	Negative	5	75	80
	Total	27	75	102
Tian’s conventional PCR	Positive	18	0	18	17.6%	91.2%
	Negative	9	75	84
	Total	27	75	102
Detection rate		26.5%

The number of positive, negative, and overall percent agreements of developed dqPCR assay compared with those of Zhang’s SYBR Green-based qPCR, Zhang’s TaqMan probe-based qPCR, or Tian’s conventional PCR was 96.3% (26/27), 98.7% (74/75), and 98.0% (100/102); 81.5% (22/27), 100.0% (75/75), and 95.1% (97/102); 66.7% (18/27), 100.0% (75/75), and 91.2% (93/102); respectively. The kappa values (95% CI) were 0.95 (0.88∼1.02), 0.87 (0.75∼0.98), and 0.75 (0.59∼0.90), respectively..

A novel PCV4 has been recently identified in Chinese pig herds (Zhang et al, 2020a; Zhang et al, 2020b; Sun et al, 2021; Tian et al, 2021) and Korean pig herds (Nguyen et al, 2021; Kim et al, 2022). Combining the PCV4 detection results from Chinese and Korean studies, it is worth noting that PCV4 was detected in healthy pigs as well as in pigs with various clinical symptoms, similar to PCV2 and PCV3. Furthermore, co-infection with PCV2, PCV3, and PCV4 was frequently observed in clinical samples. Therefore, a sensitive and specific diagnostic method for rapid and simple detection of PCV4 infection is needed. Since the first identification of PCV4, cPCR (Ha et al, 2021; Tian et al, 2021), SYBR Green-based qPCR (Zhang et al, 2020a; Hou et al, 2021; Nguyen et al, 2021), and TaqMan probe-based qPCR (Chen et al, 2020; Zhang et al, 2020b) have been developed for PCV4 detection. However, TaqMan probe-based qPCR is more desirable for PCV4 detection from clinical samples because it is more sensitive than cPCR and more specific than SYBR Green-based qPCR. Moreover, these previously reported cPCR and qPCR assays have never used the IPC for avoiding false-negative results. The aim was to develop a more reliable TaqMan probe-based dqPCR assay for simultaneous amplification of PCV4 and IPC. The newly developed dqPCR assay for PCV4 detection has several advantages. It is highly specific for the PCV4 Cap gene DNA because the primers/probe set is designed based on the highly conserved Cap gene sequence of all available 49 PCV4 sequences retrieved from GenBank. The PCV4 Cap gene sequences are highly conserved among the PCV4 strains and have low nucleotide identity with PCV1, PCV2, PCV3, and other animal circoviruses (Zhang et al, 2020a; Sun et al, 2021; Kim et al, 2022); hence, they are suitable for designing PCV4-specific primers/probe for the molecular diagnostic assay. The dqPCR results showed that the PCV4 Cap gene-targeted primers/probe set, specifically amplified the PCV4 Cap gene but did not amplify the other PCVs and swine pathogens, demonstrating that the newly designed primers/probe set is highly specific to the PCV4 Cap gene (Table 1). Furthermore, for the development of the dqPCR assay, we used the pig GAPDH as an endogenous internal control that is already present in most sample types of pigs and does not require additional steps for internal control preparation or spike-in inoculation (Duvigneau et al, 2005). The performance of the GAPDH (IPC) in the dqPCR was evaluated using analytical analysis, which demonstrated no interaction with the PCV4 targets and showed no effect on the amplification efficiency and sensitivity of the assay for PCV4 detection (Fig. 1). GAPDH (IPC) was amplified using the dqPCR in all tested pig clinical samples, thus ensuring the high reliability of dqPCR. The analytical sensitivity of the developed dqPCR assay was 100 times more sensitive than that of Tian’s cPCR and 10 times more sensitive than that of Zhang’s SYBR Green-based qPCR, and Zhang’s TaqMan probe-based qPCR. These results demonstrated that the developed dqPCR assay is suitable for use as a diagnostic method for PCV4 (Fig. 1, 2).

The analytical sensitivity of the developed dqPCR assay was 100 times more sensitive than that of Tian’s cPCR and 10 times more sensitive than that of Zhang’s SYBR Green-based qPCR, and Zhang’s TaqMan probe-based qPCR (Fig. 1, 2). Subsequently, clinicals evaluation results with 102 pig samples showed that the PCV4 detection rate of the developed dqPCR assay was higher than that of Tian’s cPCR or Zhang’s TaqMan probe-based qPCR assay and similar to that of Zhang’s SYBR Green-based qPCR assay (Table 4). These results demonstrated that the developed dqPCR assay is suitable for use as a diagnostic method for PCV4 from suspected pig samples.

Presently, there are two reports on PCV4 in Korea. Nguyen et al (2021) was the first detected PCV4 in Korea from clinically sick or healthy pigs with a relatively low rate of 3.28% (11/353) (Nguyen et al, 2021). Kim et al (2022) investigated the prevalence of PCV4 in diseased pig samples collected in 2020 and 2021, and the positive rates of PCV4 in individual pig samples and at the farm level were 39.3% (57/145) and 45.7% (32/70), respectively. The positive rate of PCV4 in the present study was 26.5% (27/102), which was much higher than that of the Nguyen’s report but slightly lower than that of the Kim’s report. Despite the differences in PCV4 prevalence among researchers, the prevalence of PCV4 in the Korean pig populations is increasing over time and may spread nationwide in the near future. As there is limited knowledge on the recently discovered PCV4 in China and Korea, further studies are needed to elucidate its association with clinical manifestations and assess its distribution and its potential impact on pig industry (Opriessnig et al, 2020). In conclusion, this study successfully developed and evaluated the dqPCR assay with IPC, which could be a promising method for sensitive and specific detection of the novel PCV4. Moreover, this assay secured high diagnostic reliability by incorporating the pig GAPDH gene as an IPC. Therefore, the dqPCR assay can be useful for etiological diagnosis, epidemiological study, and control of the PCV4 infections.

This research was supported by the Commercializations Promotion Agency for R&D Outcomes (COMPA) grant funded by the Korean Government (Ministry of Science and ICT) (R&D project No. 1711139487), Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through “Animal Disease Management Technology Development Program (321015-01-1-CG000)”, and “Cooperative Research Program for Agriculture Science and Technology Development (Project No. PJ01561102)” funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA), Rural Development Administration (RDA), Republic of Korea.

No potential conflict of interest relevant to this article was reported.