Korean Journal of
Veterinary Service

Psittacine beak and feather disease (PBFD) and budgerigar fledgling disease (BFD) are common viral infectious diseases of psittacine birds (Katoh et al., 2010). PBFD caused by PBFD virus (PBFDV) belonging to the genus Circovirus in the family Circoviridae and is characterized by severe feather and beak deformities that result in eventual death; it is thus an important cause of morbidity and mortality in wild and captive psittacine birds (Ritchie et al., 1989). Although psittacine birds are natural hosts of PBFDV, the virus is now recognized as a multispecies pathogen that can also infect non-psittacine birds (Varsani et al., 2011). PBFDV infections have been reported in different psittacine species in many countries where psittacine birds are not naturally found, probably due to the international trade of pet psittacine birds (Varsani et al., 2011; Ogawa et al., 2013; Harkins et al., 2014). BFD caused by Aves polyomavirus 1 (APyV) belonging to the genus Gammapolyomavirus in the family Polyomaviridae and is characterized by acute infections with polyuria, subcutaneous hemorrhage, dyspnea and depression, as well as chronic infections of adult psittacine birds (Ritchie et al., 1991; Stoll et al., 1993). Psittacine birds persistently or sub-clinically infected with the virus can intermittently shed the virus through feces and feathers, which can serve as a viral reservoir for transmitting the virus to susceptible psittacine birds (Rahaus and Wolff, 2005).

Early diagnosis and isolation of infected birds are key to preventing the transmission of these viruses to healthy birds. Therefore, there is an urgent need to develop a diagnostic method for the rapid and sensitive detection of the virus from suspected birds in the field (Katoh et al., 2008; Katoh et al., 2010). PBFDV infection has been diagnosed by several approaches including hemagglutination and hemagglutination inhibition tests (Ritchie et al., 1991), electron microscopy (Ritchie et al., 1989), in situ hybridization (Ramis et al., 1994), conventional polymerase chain reaction (cPCR) (Ypelaar et al., 1999; Ritchie et al., 2003), real-time quantitative PCR (qPCR) (Raue et al., 2004; Katoh et al., 2008; Shearer et al., 2009; Sarker et al., 2014; Černíková et al., 2017), and loop-mediated isothermal amplification (LAMP) (Kuo et al., 2015; Chae et al., 2020). APyV infection has also been diagnosed using various methods including immunofluorescent antibody staining (Graham and Calnek, 1987; Phalen et al., 1996), in situ hybridization (Ramis et al., 1994), electron microscopy (Davis et al., 1981), virus-neutralization tests (Phalen et al., 1993), enzyme-linked immunosorbent assay (Khan et al., 2000), cPCR (Phalen et al., 1991; Johne and Müller, 1998; Tomasek et al., 2007), qPCR (Katoh et al., 2008), and LAMP (Park et al., 2019). Among them, cPCR and qPCR methods are widely used for the detection of PBFDV or APyV due to their higher specificity and sensitivity.

However, considering that the clinical manifestations of PBFDV and APyV infections are similar and that coinfection of the two viruses are frequently identified in psittacine birds (Gibson et al., 2019), a multiplex diagnostic tool that can simultaneously and differentially detect PBFDV and APyV in a single reaction is more desirable than a monoplex diagnostic assay that can detect each of the viruses in separate two reactions. To address this issue, multiplex assays have been previously developed, including a duplex cPCR for simultaneous detection of PBFDV and APyV (Ogawa et al., 2005) and a triplex qPCR for simultaneous detection of PBFDV, APyV, and Psittacid herpes virus 1 (PsHV-1) (Gibson et al., 2019). Considering the superior sensitivity, specificity, and reliability of qPCR over cPCR, the triplex qPCR developed by Gibson et al. (2019) considered more suitable than the duplex cPCR developed by Ogawa et al. (2005). However, because the diagnostic performance of the triplex qPCR has been validated using only formalin-fixed, paraffin embedded tissue samples, it is uncertain whether this assay can be suitable for field clinical samples obtained from psittacine birds with a variety of clinical signs (Gibson et al., 2019).

On the other hand, a most recent study in 2024 indicated that previously developed PCR assays for PBFDV and APyV were found to be unsuitable for reliable detection of currently circulating viral strains due to sequence mismatches between most published primers and reference sequences (Ko et al., 2024). Therefore, in this study, we developed a TaqMan probe-based duplex real-time quantitative PCR (dqPCR) assay to reliably detect PBFDV and APyV in a single reaction using carefully evaluated primers and probes and evaluated its diagnostic performance using clinical samples obtained from psittacine birds in Korea. In addition, we investigated the prevalence and co-infection status of these two viruses in Korean psittacine birds based on the results of the dqPCR assay developed in this study.

Samples and nucleic acid extraction

Korean PBFDV (KBFDV-19111; GenBank Accession No. MN025417) and APyV (KAPV-1443; GenBank Accession No. MK516256) strains were obtained from our previous studies (Kim et al., 2014a; Kim et al., 2014b) and used for the construction of a DNA standard. Previously identified avian bornavirus (ABV)- and Chlamydia psittaci-positive samples in our laboratory were additionally selected for specificity testing of the dqPCR assay (Kim et al., 2014c; Chae et al., 2020). For the clinical evaluation of the developed dqPCR assay, 87 clinical samples (11 tissues, 31 feathers, 19 bloods, and 26 rectal swabs) were collected from PBFD- and BFD-suspected or asymptomatic psittacine birds in 2023. All of the clinical samples were submitted to the veterinary diagnostic laboratory of Kyungpook National University for etiological diagnosis of psittacine diseases by veterinarians from local animal clinics after receiving verbal consent from the owners. Total nucleic acids were extracted from each sample using a commercial nucleic acid extraction kit (GeneAll Biotechnology, Korea) as previously described (Johne and Müller, 1998; Ritchie et al., 2003; Ogawa et al., 2005) and used as a template for the developed dqPCR and other molecular assays. All samples and extracted nucleic acids were stored at −80℃ until use.

Design of primers and probes

Two sets of primers and probes were used in the establishment of the dqPCR for differential detection of PBFDV and APyV. A set of primers and probe for the detection of PBFDV was adopted from a previous report (Černíková et al., 2017), while a set of primers and probe for the detection of APyV was newly designed in this study. Based on previous studies (Katoh et al., 2009; Zhuang et al., 2012; Henriques et al., 2018), the T gene of APyV was selected for designing primers and probe for the dqPCR and all available APyV T gene sequences were collected from the National Center for Biotechnology Information (NCBI) GenBank database. Based on highly conserved regions of the APyV T gene, several candidate primers and probes were designed using Primer Express software (version 3.0) (Applied Biosystems). To facilitate the establishment of the dqPCR, the sequences of the primers and probe for APyV were carefully selected to have melting temperatures similar to those of the primers and probe for PBFDV. The lengths of amplicons for PBFDV and APyV were 213 and 172 base pairs (bp), respectively (Table 1). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to check the specificity of the primers and probe sets. Each primer and probe sequence for PBFDV or APyV used in this study showed 100% homology with the corresponding sequences of the viruses. In addition, we evaluated the specificity of the dqPCR assay using each primer/probe set in silico using FastPCR software, version 5.4 (PrimerDigital Ltd., Finland), according to the developer’s instructions (Kalendar et al., 2011). The predictive success rate of dqPCR with each primer/probe set was 95.4% (83/87) for PBFDV and 100% (30/30) for APyV with the complete gene available in NCBI, showing that the dqPCR assay with the selected primer/probe sets is highly specific and can be used to detect PBFDV or APyV. For the accurate and differential detection of PBFDV and APyV by the dqPCR in a reaction tube, it is essential that the sequence-specific probes are labeled with reporter dyes with distinct fluorescence spectra or minimal overlap (Navarro et al., 2015). For the simultaneous and differential detection of the ORF V1 gene of PBFDV and the T gene of APyV in a single reaction, probes for each viral genes were labeled differently at the 5′ and 3′ ends with 6-carboxyfluorescein (FAM) and Black Hole Quencher 1 (BHQ 1) for PBFDV and hexachlorofluorescein (HEX) and BHQ1 for APyV, according to the manufacturer’s instructions (Bioneer, Daejeon, Korea) (Table 1).

Table 1 . Primers and probes for duplex real-time quantitative polymerase chain reaction (dqPCR) and conventional PCR (cPCR) in this study.

Method	Primer/probe	Sequence (5’-3’)a	Positionb	Tm (℃)	Amplicon (bp)	Reference
dqPCR	PBFDVF	TAAGAAGCGRYTGAGCGCGCTTAAGAA	317∼343	69.60	213	Černíková et al. (2017)
	PBFDVR	AACTCTCGCGCGACTTCCTTCATTT	505∼529	68.3
	PBFDVP	FAM-CGGTGACCRTCTCTCGCCACAATGCC-BHQ1	438∼463	72.2
	APyVF	CAGTCCGGAAGCGTTCTTTGA	3765∼3783	64.5	172	In this study
	APyVR	GGTCGACACATATCGACGACCA	3915∼3936	65.4
	APyVP	HEX-ACGCTCATCCCTTGTCATGGTCGCTG-BHQ1	3785∼3810	71.2
cPCR	PBFDVF	AACCCTACAGACGGCGAG	189∼206	56.9	717	Ypelaar et al. (1999)
	PBFDVR	GTCACAGTCCTCCTTGTACC	886∼905	54.7
	APyVF	CAAGCATATGTCCCTTTATCCC	4303∼4324	53.3	310	Johne and Müller (1998)
	APyVR	CTGTTTAAGGCCTTCCAAGATG	4591∼4612	53.8

^aBold text in sequences of PBFDVF and PBFDVP primers represent a degenerative base: R, A or G; Y, C or T..

^bGenome position of primer- and probe-binding sequences according to the complete genome sequence of Psittacine beak and feather disease virus (PBFDV) and Aves polyomavirus 1 (APyV) (GenBank accession no. AF071878 and no. NC_004764, respectively)..

FAM, 6-carboxyfluorescein; HEX, hexachlorofluorescein; BHQ1, Black Hole Quencher 1..

Construction of DNA standards

DNA standards of PBFDV (V1 gene) and APyV (T genes) were obtained from our previous studies (Park et al., 2019; Chae et al., 2020). Briefly, each of the amplified DNA products was purified and cloned into the pTOP TA V2 vector (TOPcloner^TM TA core Kit; Enzynomics, Korea), and plasmids containing the PBFDV V1 or APyV T gene were purified using a commercial kit (GeneAll Expin^TM Combo GP 200 miniprep kit, GeneAll Biotechnology, Korea). The concentration and purity of each plasmid sample were determined by measuring the absorbance at 260 nm using a NanoDrop Lite (Thermo Fisher Scientific, USA). The copy numbers of each cloned gene were quantified using a previously described method (Park et al., 2019; Chae et al., 2020). Ten-fold dilutions of PBFDV or APyV DNA sample (from 10⁶ to 10⁰ copies/μL) were stored at −80℃ until use.

Optimization of dqPCR conditions

Before optimizing of dqPCR, each monoplex qPCR assay using each set of primers and probe for PBFDV or APyV was performed using a commercial qPCR kit (Premix Ex Taq^TM Probe qPCR, Takara, Shiga, Japan) and CFX96 Touch^TM Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The 25-μL reaction mixture contained 12.5 μL of 2× Premix Ex Taq buffer with enzyme, 0.4 μM of each primer and probe, and 5 μL of cloned PBFDV or APyV DNA (10⁴ copies/μL) and was prepared according to the manufacturer’s instructions. To optimize the dqPCR conditions, the concentrations of both sets of primers and probes were optimized while keeping other reaction components the same as those used in the monoplex qPCR. The monoplex qPCR and dqPCR programs were identical and consisted of 3 min at 95℃ for initial denaturation, followed by 40 cycles of 10 s at 95℃ and 30 s at 60℃ for amplification. FAM and HEX fluorescence signals were detected at the end of each annealing step. Results obtained from monoplex and dqPCR were interpreted according to previously described guidelines (Broeders et al., 2014), i.e., samples with cycle threshold (Ct) values less than 40 (<40) were considered positive, and samples with Ct values greater than 40 (>40) were considered negative.

Specificity and sensitivity of dqPCR

To evaluate the specificity of the dqPCR assay, the assay was performed with total nucleic acids extracted from PBFDV-, APyV-, ABV-, and Chlamydia psittaci-positive samples, five avian pathogens including Newcastle disease virus (NDV, La sota vaccine strain), Marek’s disease virus (MDV, SB-1 vaccine strain), infectious bronchitis virus (IBV, K2 vaccine strain), fowl adenovirus (FAdV, Kr-Changnyeong Korean isolate) and subtype H9N2 avian influenza virus (AIV, A/Chicken/Korea/01310/2001 strain), and porcine circovirus type 2 (PCV2, PCK0201 strain). The sensitivity of the dqPCR assay was determined in triplicate using serial dilutions (from 10⁶ to 10⁰ copies/μL) of each plasmid DNA containing the target genes of PBFDV or APyV, and the results were compared to those of the respective monoplex qPCR assay. For data analysis, CFX96 Touch^TM Real-Time PCR Detection software (Bio-Rad) was used to create a standard curve with Ct values of the 10-fold dilutions of PBFDV or APyV standard DNA (from 10⁶ to 10⁰ copies/μL). The detection software also calculated the correlation coefficient (R²) of standard curve, the standard deviations of the results, and PBFDV or APyV DNA copy number of the samples based on the standard curve.

Precision of dqPCR

The intra-assay precision (repeatability) and inter-assay precision (reproducibility) of the dqPCR assay for PBFDV and APyV were evaluated by testing three different concentrations (high, medium, and low) of each viral standard gene. The concentrations of the standard DNAs for PBFDV or APyV were 10⁶, 10⁴, and 10² copies/reaction. The intra-assay variability was analyzed in triplicate using each dilution on the same day, whereas the inter-assay variability was analyzed in six independent experiments performed by two operators on different days according to the MIQE guidelines (Bustin et al., 2009). The coefficient of variation (CV) for the Ct values was determined based on the intra- or inter-assay results and expressed as a percentage of the mean value together with the standard deviation values.

Comparative evaluation of dqPCR

Clinical evaluation of the optimized dqPCR assay was conducted using 87 clinical samples collected from different psittacine species. The results of dqPCR assay were compared to the results of previously reported cPCR assays for PBFDV (Ypelaar et al., 1999) and APyV (Johne and Müller, 1998). The previous PCR assays were carried out using a commercial PCR kit (Inclone Biotech, Korea) and CFX96 Touch^TM Real-Time PCR Detection System (Bio-Rad, USA) as previously described (Johne and Müller, 1998; Ypelaar et al., 1999).

Interpretation of the dqPCR assay

The fluorescence FAM signals for PBFDV and HEX for APyV were generated by each of the corresponding monoplex qPCR assays (Table 2, Fig. 1). For simultaneous and differential detection of the V1 gene of PBFDV and T gene of APyV in a single reaction tube, both sets of primers and probes for the dqPCR were used with the same qPCR conditions in a multiplex format. The results of the dqPCR using the optimized primer concentration (0.4 μM of each primer and 0.4 μM of each probe for PBFDV and APyV) showed that two FAM signals for PBFDV and HEX signals for APyV could be detected simultaneously by the assay (Fig. 1). These results showed that the dqPCR could successfully amplify both target genes of PBFDV and APyV in a single reaction without spurious amplification and significant crosstalk between both fluorescent reporter dyes.

Table 2 . Specificity of duplex real-time quantitative polymerase chain reaction using Psittacine beak and feather disease virus (PBFDV) and Aves polyomavirus 1 (APyV)-specific primers and probe sets.

Pathogen	Strain	Amplification of target gene
		PBFDV (FAM)	APyV (HEX)
Beak and feather disease virus	KBFDV-19111	+	−
Aves polyomavirus 1	KAPyV-19143	−	+
Avian bornavirus	Field sample	−	−
Chlamydophila psittaci	Field sample	−	−
Newcastle disease virus	La sota vaccine strain	−	−
Marek’s disease virus	SB-1 vaccine strain	−	−
Infectious bronchitis virus	K2 vaccine strain	−	−
Fowl adenovirus	Kr-Changnyeong Korean isolate	−	−
Avian influenza virus (H9N2)	A/Chicken/Korea/01310/2001 strain	−	−
Porcine circovirus type 2	PCK0201 strain	−	−

FAM, 6-carboxyfluorescein; HEX, hexachlorofluorescein..

Figure 1. Limit of detection (LOD) and standard curves for monoplex and duplex real-time quantitative polymerase chain reaction (dqPCR) for Psittacine beak and feather disease virus (PBFDV) and Aves polyomavirus 1 (APyV). LOD and standard curves of monoplex qPCR for PBFDV (A, E), APyV (B, F), and dqPCR for PBFDV and APyV (C, G). LODs of conventional PCRs for PBFDV (D) and APyV (H). Lanes 1∼7 are 10-fold serial dilutions of the PBFDV and APyV standard DNAs (from 5×10⁶ to 10⁰ copies/reaction), respectively. The coefficient of determination (R²) and the equation of the regression curve (y) were calculated using CFX Manager Software (Bio-Rad). NC, negative control (nuclease-free distilled water).

Specificity and sensitivity of the dqPCR assay

Each set of the primers and probe for PBFDV and APyV only detected the DNA corresponding to their respective viruses. No positive result was obtained from the other pathogens tested (Table 2, Fig. 1A, 1B). As expected, the V1 gene of PBFDV and T gene of APyV were co-amplified from a mixed sample of PBFDV and APyV (Fig. 1C). The results indicated that the dqPCR assay with two sets of primers and probes could specifically and differentially detect PBFDV and APyV. In terms of V1 gene of PBFDV and T gene of APyV copy number, the limit of detection (LOD) of the dqPCR was below 50 gene copies per reaction for PBFDV and APyV, which was similar to the LODs obtained from each of the corresponding monoplex qPCR assays. As the LODs of conventional PCRs for PBFDV and APyV were determined to be 500 gene copies/reaction, respectively, the developed dqPCR was 10-fold more sensitive than conventional PCR assays for both viruses (Fig. 1D). To determine the linearity of the reaction and PCR efficiency, standard curves for target genes were generated by plotting their Ct values against their dilution factors. High correlation values (R²>0.99) between the Ct values and dilution factors were found for the monoplex qPCR and dqPCR assays (Fig. 1).

Precision of the dqPCR assay

To evaluate the precision of the dqPCR, three different concentrations (high, medium, and low) of each standard DNAs were tested in triplicate in six independent runs carried out by two experimenters on different days. The coefficients of variation (CV) within runs (intra-assay variability) ranged from 2.57% to 4.97% for PBFDV and 0.63% to 2.98% for APyV, respectively. The CV between runs (inter-assay variability) ranged from 0.71% to 3.41% for PBFDV and 1.39% to 1.45% for APyV, respectively (Table 3).

Table 3 . Intra- and inter-assay coefficients of variation for the duplex real-time quantitative polymerase chain reaction (dqPCR).

Pathogen	Dilution (copies/reaction)	Intra-assay variability				Inter-assay variability
		Mean	SD	CV (%)		Mean	SD	CV (%)
Beak and feather disease virus	High (106)	19.64	0.98	4.97		19.76	0.42	2.12
	Medium (104)	25.67	0.69	2.68		26.25	0.19	0.71
	Low (102)	33.07	0.85	2.57		33.89	1.15	3.41
Aves polyomavirus 1	High (106)	19.13	0.12	0.63		19.03	0.27	1.44
	Medium (104)	26.05	0.78	2.98		25.97	0.38	1.45
	Low (102)	33.41	0.32	0.96		33.53	0.47	1.39

The mean value, standard deviation (SD), and coefficient of variation (CV) were determined based on the Ct values for the dqPCR assay..

Clinical diagnostic performance of the dqPCR assay

To evaluate the clinical diagnostic performance of the developed dqPCR assay, 87 clinical samples were tested, and the results were compared with the results of previously described PCR methods for PBFDV and APyV (Johne and Müller, 1998; Ypelaar et al., 1999). The detection rates for PBFDV and APyV using the dqPCR assay were 55.2% (48/87) and 13.8% (12/87), whereas the detection rates for PBFDV and APyV using the previous cPCR assays were 35.6% (31/87) and 13.8% (12/87), respectively (Table 4). The results of the new dqPCR assay for APyV were in perfect agreement with those of the previous cPCR assay. However, 17 more clinical samples were determined as APyV-positive using the new dqPCR assays when compared with the previous APyV cPCR assay. As a result, the positive, negative, and overall agreements between the new dqPCR and previous cPCR assays were 100.0% (31/31), 69.6% (39/56), and 80.5% (70/87) for PBFDV (Table 4). These clinical evaluations demonstrate that the clinical diagnostic sensitivity of the new dqPCR assay was higher than that of the previous cPCR for PBFDV and comparable to that of the previous cPCR for APyV. Based on the diagnostic results of the dqPCR assay, the prevalence of PBFDV or APyV was determined to be 55.2% or 13.8% in the tested 87 clinical samples, respectively. Furthermore, co-infection status of PBFDV and APyV was analyzed in this study. The results showed that 42.5% (37/87) or 1.2% (1/87) of the tested samples were singularly infected with PBFDV or APyV, whereas 12.6% (11/87) of tested samples were found to be dually infected with both viruses (Fig. 2).

Table 4 . Comparison of diagnostic results between the newly developed duplex real-time quantitative polymerase chain reaction (dqPCR) and previous conventional PCR (cPCR) assays for detecting Psittacine beak and feather disease virus (PBFDV) and Aves polyomavirus 1 (APyV).

Pathogen	Method	No. of tested	No. of positive	Detection rate (%)	Agreement (%)†
PBFDV	New dqPCR	87	48	55.2	80.5
	Previous cPCR	87	31	35.6
APyV	New dqPCR	87	12	13.8	100.0
	Previous cPCR	87	12	13.8

^†The positive, negative, and overall agreements between the newly developed dqPCR and previously described cPCR assays were 100.0% (31/31), 69.6% (39/56), and 80.5% (70/87) for PBFDV and all 100% for APyV, respectively. The overall agreements were presented in this table..

Figure 2. Prevalence and coinfection status of Psittacine beak and feather disease virus (PBFDV) and Aves polyomavirus1 (APyV) determined by the newly developed duplex real-time quantitative polymerase chain reaction assay using 87 clinical samples collected from pet psittacine birds in Korea.

PBFDV and APyV cause psittacine diseases with similar clinical symptoms and are highly prevalent viral pathogens reported in various species of wild and captive psittacine birds (Katoh et al., 2010). Psittacine birds infected with these two viruses can shed the viruses for long periods of time with or without clinical signs. Therefore, early diagnosis and isolation of infected birds are crucial to reduce the risk of viral transmission and control these viral infections (Tomasek et al., 2007; Katoh et al., 2010; Harkins et al., 2014). Although a multiplex qPCR assay has been described for differential detection of PBFDV, APyV, and PsHV-1 (Gibson et al., 2019), its diagnostic performance is not fully evaluated using psittacine clinical samples in the field. Therefore, a novel dqPCR assay using a new combination of primers and probes was newly developed for reliable and differential detection of PBFDV and APyV for expanding clinical applicability in this study.

The newly developed dqPCR assay using two sets of primers and probes could specifically amplify both target genes (V1 gene of PBFDV and T gene of APyV) in a single reaction without spurious amplification and significant crosstalk between both fluorescent reporter dyes (Table 1, Fig. 1). The LODs of the dqPCR assay were determined to be <50 copies/reaction for the standard DNAs of PBFDV and APyV, respectively (Fig. 1), which were at least 10-fold lower than those of previously reported cPCR assays for the viruses (Johne and Müller, 1998; Ypelaar et al., 1999). Thus, the sensitivity of the dqPCR assay was sufficient to detect PBFDV and APyV in clinical samples. Furthermore, the precision (repeatability and reproducibility) of the dqPCR assay for the detection of two viral genes was acceptable for molecular diagnostic assay as shown in Table 3 (Bustin et al., 2009; Broeders et al., 2014).

In the clinical evaluation, the diagnostic sensitivity of the new dqPCR assay for PBFDV or APyV was 55.2% (48/87) or 13.8% (12/87), which was higher than that of the previous PBFDV cPCR (35.6%, 31/87) or consistent with that of the previous APyV cPCR (13.8%, 12/87), respectively (Table 4). For PBFDV, 17 more clinical samples were tested negative by the previous cPCR but were determined to be positive by the new dqPCR, indicating that the new dqPCR was more sensitive than the previous cPCR for detecting PBFDV in clinical samples. It is unclear why the previous cPCR assay failed to detect PBFDV in discordant clinical samples, but these false-negative results obtained by the previous cPCR are thought to be due to the low sensitivity of the previous cPCR as shown in Fig. 1. Therefore, the new dqPCR assay developed in this study was highly recommendable for the differential detection of PBFDV and APyV in clinical samples of psittacine birds.

PBFDV and APyV have been distributed in many species of psittacine birds worldwide. The prevalence of PBFDV and APyV ranged from less than 10% to over 90% (Martens et al., 2020; Blanch-Lázaro et al., 2024; Ko et al., 2024) and 2.7% to 25% (Ogawa et al., 2006; Adiguzel et al., 2020; Valastanova et al., 2021; Nath et al., 2023; Khosravi et al., 2024), respectively, depending on the bird species, age group, environmental conditions, and geographic location sampled. In previous Korean studies, the prevalence of PBFDV and APyV were determined to be 36.0% (31/86) and 37.8% (28/74) in psittacine bird samples collected in 2018∼2019, respectively (Park et al., 2019; Chae et al., 2020). In the present study, the detection rate of PBFDV or APyV was 55.2% or 13.8% in clinical samples collected in 2022 (Table 4), which was higher than that of previous study for PBFDV (Chae et al., 2020) or lower than that of previous study for APyV (Park et al., 2019), respectively. It is unclear why the prevalence of the two viruses differed between the Korean studies, but it may be due to differences in the species and health state of the psittacine bird sampled and diagnostic methods used between the studies. In this regard, it was noteworthy that previously developed cPCR assays were not suitable for detecting currently circulating PBFDV and APyV due to the sequence mismatches between primers and target genes of the viruses (Chae et al., 2020; Ko et al., 2024).

Under the high prevalence of PBFDV and APyV in global psittacine bird populations, coinfections of both viruses have been frequently reported in several countries, and the coinfection rates varied depending on the country studied such as 0.8% in Chile (González-Hein et al., 2019), 4% in Bangladesh (Nath et al., 2023), 4.17% in Brazil (Philadelpho et al., 2022), 10.3% in Taiwan (Hsu et al., 2006), and 12.4% in Eastern Turkey (Adiguzel et al., 2020). In this study, the rate of coinfection with PBFDV and APyV was 12.6% in the 87 clinical samples tested (Fig. 2). This was higher than the rates reported in Chile, Bangladesh, and Brazil, but similar to the rates reported in Taiwan and Eastern Turkey. Surprisingly, the coinfection rate of the two viruses was higher than that of the singular infection rate of APyV (1.2%, 1/87) but lower than that of the singular infection rate of PBFDV (42.5%, 37/87) in the present study (Fig. 2). It is unclear why the coinfection rate of the two viruses was higher than that of singular infection rate of APyV in Korean psittacine birds. Therefore, further studies are required to elucidate the pathogenic role of PBFDV and APyV and synergistic mechanism of coinfection of the viruses in psittacine birds.

In conclusion, a sensitive and specific dqPCR assay capable of differentially detecting PBFDV and APyV was successfully developed in this study. This assay has proven to be more sensitive than previously described cPCR assays for detecting PBFDV and APyV in clinical samples. Therefore, the new dqPCR assay will be a promising diagnostic tool for PBFDV and APyV infections in suspected psittacine birds and will be useful for etiological diagnosis, epidemiological studies, and the control of these virus infections. The prevalence and coinfection status of PBFDV and APyV identified in this study will help expand our knowledge of the epidemiology of PBFDV and APyV infections in Korea. Further studies are needed to determine the exact prevalence of PBFDV and APyV infections in Korean psittacine bird populations and to elucidate the pathogenic role and synergistic effect of the two viruses in psittacine birds.

This research was supported by Commercialization of strategic technology research results Program through INNOPOLIS Foundation funded by the Ministry of Science and ICT (grant number, 2024-GJ-RD-0033/project title, Commercialization and industrialization of multi-diagnostic kits for rapid diagnosis of infectious diseases in pet and industrial animals in the Honam region).

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study was conducted in 2024 and was beyond the purview of the Institutional Animal Care and Use Committee (IACUC) at Kyungpook National University (KNU), as the KNU IACUC only evaluates proposals using laboratory animals maintained in indoor facilities and not research involving outdoor animals.

No potential conflict of interest relevant to this article was reported.