Korean Journal of
Veterinary Service

Pacheco’s disease (PD) is an acute, highly contagious disease that is often fatal to psittacine birds. This disease was first identified from psittacine birds (parrots) in 1929 in Brazil (Pacheco and Bier, 1930). Since then, the disease has been reported in various countries and continents, including the USA, Europe, South America, South Africa, and Japan (Gough and Alexander, 1993; Katoh et al., 2010). Such a global transmission of the disease is believed to be due to the international trade of pet parrots, as like in other parrot diseases (Tomaszewski et al., 2003; Franzo et al., 2022). PD is caused by psittacid herpesvirus-1 (PsHV-1), also known as psittacid alphaherpesvirus-1 and now renamed Iltovirus psittacidalpha1. This species belongs to the genus Iltovirus in the family Orthoherpesviridae of the order Herpesvirales (https://ictv.global/taxonomy). The PsHV-1 genome is approximately 163 kb in length and contains 73 predicted open reading frames (ORFs) (Thureen and Keeler, 2006). Based on the sequences of the UL16 gene, which is associated with the viral capsid assembly, the different PsHV-1 strains found worldwide can be divided into four genotypes. All four genotypes are thought to cause PD in psittacine birds, but their pathogenicity may differ (Tomaszewski et al., 2003).

Clinical signs are rarely observed in PD-affected birds, as they typically suffer sudden deaths. Therefore, PD should be suspected in any psittacine birds that die suddenly without showing clinical signs (Katoh et al., 2010). However, sudden deaths of psittacine birds can also be caused by psittacine beak and feather disease virus (PBFDV), avian polyomavirus (APV), avian bornavirus (ABV), or avian paramyxovirus serotype 1 (APMV-1). Therefore, the etiological diagnosis of the causal virus is essential to determine whether psittacine birds died due to PD (Katoh et al., 2010). Currently, molecular diagnostic methods such as polymerase chain reaction (PCR) and real-time PCR are widely used for the routine diagnosis of psittacine viral pathogens due to their rapid speed and high specificity and sensitivity (Tomaszewski et al., 2003; Styles et al., 2005).

In Korea, the first case of PD was reported in 2003 from dead Bourke’s parakeets (Neophema bourkii) showing neurological signs (Kwon et al., 2003). The study identified herpesvirus particles in brain tissues using electron microscopy, but no molecular analysis was performed to determine the genotype of the virus. Considering that PsHV-1 can latently infect most psittacine bird species and these latently infected birds can be a potential source of viral transmission, it is expected that PsHV-1 is already widely distributed across the Korean psittacine bird population (Tomaszewski et al., 2006). However, there were no additional reports of PD in Korea since the first report in 2003 (Kwon et al., 2003). Therefore, more extensive studies are needed to determine the prevalence and genetic characteristics of the virus in suspected PD cases among Korean pet parrots.

In this study, we identified PsHV-1 from a deceased rosella parakeet (Platycercus elegans) submitted from an aviary located in Gyeongsangbuk-do province, Korea. Furthermore, the genotype of the virus was determined by sequencing the partial UL gene of the detected virus. These results contribute to our understanding of the epidemiology and genetic characteristics of PsHV-1 among pet parrots in Korea.

Samples and nucleic acid extraction

Among the 55 parrots under six months of age raised in an aviary in Gyeongsangbuk-do province, Korea, 12 suffered acute deaths with few or no premonitory signs over two weeks. The observed clinical signs included profuse, watery diarrhea and depression, leading to death within 24 hours. No treatment was conducted for the affected birds due to their sudden deaths. Six of the affected birds – one golden conure (Guaruba guarouba), two rosella parakeets (Platycercus elegans), and three green-cheeked parakeets (Pyrrhura molinae) – were submitted to the Veterinary Diagnostic Laboratory in the College of Veterinary Medicine at Kyungpook National University for etiological diagnosis. As the carcasses were stored in a freezer for several days before submission, clinical and histopathological examinations could not be performed. Instead, the internal organs of the birds, including liver, lung, kidney, and intestines, were collected and subject to molecular testing for etiological diagnosis. Total nucleic acids were extracted from 200 µL of homogenized tissue samples using a TANBead Nucleic Acid Extraction Kit with a fully automated magnetic bead operating platform (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan), according to the manufacturer’s protocol. All tested samples and total nucleic acids were allocated and stored at −80℃ until use.

Molecular detection of Psittacine viral pathogens

For etiological diagnosis, five major viral pathogens were tested by previously described assays: PCR for PBFDV, APV, and PsHV-1; reverse transcription PCR (RT-PCR) for ABV and APMV-1. For these assays, pathogen-specific primer sets were used (Table 1). PCR was performed with a commercial PCR kit (Excel TB 2X Taq premix; Inclone, South Korea) according to previously described PCR protocols for PBFDV (Ypelaar et al., 1999; Kim et al., 2014b), APV (Johne and Müller, 1998; Kim et al., 2014c), and PsHV-1 (Tomaszewski et al., 2003; Styles et al., 2005), and the manufacturer’s protocol, respectively. RT-PCR was performed with a commercial one-step RT-PCR kit (PrimeScript^TM One-Step RT-PCR Kit Ver. 2, Takara Bio, Kusatsu, Shiga, Japan) according to previously described RT-PCR protocols for ABV (Guo et al., 2012; Kim et al., 2014a) and APMV-1 (Creelan et al., 2002) and the manufacturer’s protocol, respectively. After subjecting the amplified DNA to 1.5% agarose gel electrophoresis and staining with NEO green dye (Neoscience, Suwon, South Korea) (Table 1), the virus-specific DNA bands were observed using an ultraviolet light transilluminator (Neoscience).

Table 1 . Primers and probes used for the detection of psittacine viral pathogens.

Pathogen	Method	Target gene (amplicon size)	Primer and probe (5’-3’)	Reference
ABV	RT-PCR	M gene (351-bp)	F: GGTAATTGTTCCTGGATGGC R: ACACCAATGTTCCGAAGACG	Guo et al. (2012)
PBFDV	PCR	ORF1 gene (717-bp)	F: AACCCTACAGACGGCGAG R: GTCACAGTCCTCCTTGTACC	Ypelaar et al. (1999)
APV	PCR	T gene (310-bp)	F: CAAGCATATGTCCCTTTATCCC R: CTGTTTAAGGCCTTCCAAGATG	Johne and Müller (1998)
PsHV-1	PCR	UL17-UL16 gene (667-bp)	F: TGCGTGGGGTTAAACTCGGAAC R: GATGTTAGGCTCGTGTAGTCG	Tomaszewski et al. (2003)
APMV-1	RT-PCR	F gene (202-bp)	F: GGTGAGTCTATCCGGARGATACAAG R: TCATTGGTTGCRGCAATGCTCT	Creelan et al. (2002)

ABV, avian bornavirus; PBFDV, psittacine beak and feather disease virus; APV, avian polyomavirus; PsHV-1, psittacid herpesvirus 1; APMV-1, avian paramyxovirus serotype 1..

Sequencing of the UL16 gene of PsHV-1

The nucleic acids of PsHV-1-positive sample (sample no. 2) were subjected to genetic characterization and genotyping through PCR amplification. The partial UL16 gene sequence (nucleotides/nt 1-419) was amplified using the PCR primer set for PsHV-1 detection previously described by Tomaszewski et al. (2003) (Table 1). The PCR amplification for sequencing was performed with a commercial PCR kit (Excel TB 2X Taq premix) according to manufacturer’s protocol and Tomaszewski et al. (2003) protocol. The PCR product was purified using a commercial kit (GeneAll Expin^TM Combo GP 200 miniprep kit, GeneAll, Seoul, the South Korea) and sequenced using the Sanger’s method by a commercial company (BIONICS, Daejeon, South Korea). Both forward and reverse strands were sequenced to ensure accuracy. The resulting sequences were analyzed and assembled using Geneious Prime (https://www.geneious.com, accessed on 5 November 2024). The partial UL16 gene sequence of KPsHV-1 was successfully obtained in this study and it was deposited in the National Center for Biotechnology Information GenBank database (GenBank accession number PQ645140).

Genetic and phylogenetic analysis

To further characterize the KPsHV-1, the UL16 gene sequence of global PsHV-1 strains with different genotypes were retrieved from the GenBank database (www.ncbi.nlm.nih.gov/genebank, accessed on 5 November 2024). The partial UL16 gene sequence of the KPsHV-1 strain was aligned with the corresponding sequences of the reference PsHV-1 strains using the MAFFT multiple sequence alignment software (v7.490) (Katoh and Standley, 2013). For phylogenetic analysis, the Geneious tree builder (RAxML 8.2.11 plugin) was used to construct a maximum likely hood phylogenetic tree using the GTR GAMMA tree model. The tree was generated through rapid bootstrapping and a search for the best-scoring analysis with 1,000 bootstrap replicates (Stamatakis, 2014). The phylogenetic tree was visualized using the iTOL phylogenetic tree viewer (Letunic and Bork, 2021).

Detection of PsHV-1 and other viral pathogens

All six parrots tested positive for PBFDV, with three (one golden conure and two rosella parakeets) positive for ABV and one (rosella parakeet) positive for PsHV-1 by PCR and RT-PCR assays for the detection of five psittacine viral pathogens. None of all six parrots were positive for APV and APMV-1 (Table 2, Fig. 1). Three parrots (three green-cheeked parakeets) were solely infected with PBFDV, while two parrots (one golden conure and one rosella parakeet) were coinfected with ABV and PBFDV. Surprisingly, one parrot (rosella parakeet; sample no. 2) was confirmed to be coinfected with three viruses: ABV, PBFDV, and PsHV-1. These results indicated that PBFDV is widely spread, and its coinfection with other viral pathogens, such as ABV and PsHV-1, is common among psittacine birds in Korea.

Table 2 . Molecular detection of major psittacine viral pathogens in the analyzed samples.

No.	Common name (species)	Detection of psittacine viral pathogens (+/−)
		ABV	PBFDV	APV	PsHV-1	APMV-1
1	Golden conure (Guaruba guarouba)	Pos	Pos	Neg	Neg	Neg
2	Rosella parakeet (Platycercus elegans)	Pos	Pos	Neg	Pos	Neg
3	Rosella parakeet (Platycercus elegans)	Pos	Pos	Neg	Neg	Neg
4	Green-cheeked parakeet (Pyrrhura molinae)	Neg	Pos	Neg	Neg	Neg
5	Green-cheeked parakeet (Pyrrhura molinae)	Neg	Pos	Neg	Neg	Neg
6	Green-cheeked parakeet (Pyrrhura molinae)	Neg	Pos	Neg	Neg	Neg

ABV, avian bornavirus; PBFDV, psittacine beak and feather disease virus; APV, avian polyomavirus; PsHV-1, psittacid herpesvirus 1; APMV-1, avian paramyxovirus serotype 1; Pos, positive; Neg, negative..

Figure 1. Results of molecular screening of psittacine viral pathogens. Viral target genes were amplified by RT-PCR assay for (A) ABV and PCR assays for (B) PBFDV and (C) PsHV-1, respectively. Lanes 1 to 6 represent each of the six parrot samples listed in Table 2.
M, 100-bp DNA marker; ABV, Avian bornavirus; PBFDV, Psittacine beak and feather disease virus; PsHV-1, Psittacidae herpesvirus 1.

Genetic and phylogenetic analyses of KPsHV-1

To genetically characterize Korean PSHV-1 (KPsHV-1), the partial UL 16 gene nucleotide (nt) sequence was obtained. Alignment of this sequence with those of the reference PsHV-1 strains revealed that KPsHV-1 belongs to genotype 1, showing 100% nt identity with the genotype 1 PsHV-1 strain previously reported in the USA (Strain 97-0001; GenBank accession number AY372243). In contrast, the UL16 gene sequence of KPsHV-1 strain was different from the sequences of genotype 2, 3, and 4 PsHV-1 strains, showing multiple nt variations (Fig. 2). For further characterization, a phylogenetic tree was constructed with four different genotypes of PsHV-1 strains. The results showed that KPsHV-1 is clustered with other genotype 1 strains reported from the USA and Brazil while being distinct from genotype 2, 3, and 4 PsHV-1 strains (Fig. 3). These findings support that the genotype 1 PsHV-1 strain was introduced and circulated in Korean psittacine bird population.

Figure 2. Alignment of nucleotide sequences of the partial UL16 genes of Korean Psittacidae herpesvirus 1 (KPsHV-1) and reference PsHV-1 strains representing four genotypes. Dots represent the identical nucleotides between the KPsHV-1 and the reference PsHV-1 strains. The shaded region highlights a nucleotide deletion in the sequence of genotype 4 PsHV-1 strain as compared to the corresponding sequence of KPsHV-1 strain.

Figure 3. Phylogenetic analysis of Korean Psittacidae herpesvirus 1 (KPsHV-1) and reference PsHV-1 strains based on the amino acid sequence of the UL16 gene. All PsHV-1 strains were classified into four distinct clusters corresponding to viral genotypes. The Korean KPsHV-1 strain detected in this study was grouped with the reference genotype 1 PsHV-1 strains.

With the increasing import of pet parrots, the introduction of various related diseases became inevitable in South Korea (Kim et al., 2022a). To date, several viral pathogens have been identified in Korean pet parrots, including ABV (Kim et al., 2014a), PBFDV (Kim et al., 2014b), and APV (Kim et al., 2014c; Kim et al., 2022b; Yun et al., 2023). In addition, herpesvirus infection in parrots was reported in 2003, but the exact etiological diagnosis was not made (Kwon et al., 2003). Therefore, genetic information about the herpesvirus that infected Korean parrots has not yet been revealed. In this study, six parrots that suffered acute deaths were subjected to etiological analysis using PCR and RT-PCR assays for specific detection of major viral pathogens. As a result, PBFDV, ABV, and PsHV-1 were detected in tested samples, but APV and APMV-1 were not detected (Table 2). All six parrots tested positive for PBFDV, with three parrots positive for ABV and one parrot positive for PsHV-1. Surprisingly, two parrots were coinfected with PBFDV and ABV, and while one parrot was coinfected with PBFDV, ABV, and PsHV-1. These results suggested that although PBFDV was the main cause of the clinical outcomes in these parrots, ABV and PsHV-1 may have also contributed to some extent. This hypothesis is supported by a previous report describing the sudden deaths of parrots due to coinfection with these three viruses (PBFDV, ABV, and PsHV-1) in their acute infection forms (Simpson et al., 1975; Katoh et al., 2010; Ma et al., 2020; Ko et al., 2024). However, further studies are required to elucidate their pathological roles and interactions of the viruses resulting in the sudden death of the parrots observed in this study.

As PBFDV, APV1, ABV, PsHV-1, and APMV-1 are considered the most prevalent viruses in psittacine birds, many studies have investigated the effects of individual infections. However, only a few studies have explored the impact of coinfections with these viruses (Antonio et al., 2024). A recent study reported that dual or triple coinfections with PBFDV, APV1 and/or PsHV-1 are common across various species of psittacine birds (Gibson et al., 2019). In this study, coinfections with PBFDV, ABV, and/or PsHV-1 were first identified in psittacine birds in Korea parrots, suggesting that coinfections with different viral pathogens may be common in Korean psittacine bird populations. Therefore, further extensive studies are needed to determine the prevalence and coinfection status of the psittacine viral pathogens in Korea. Moreover, advanced molecular diagnostic methods are needed for the differential and simultaneous detection of these viral infections in Korean psittacine birds.

Genetic analysis of the partial UL16 gene revealed that KPsHV-1 identified in this study belongs to genotype 1, showing 100% homology with the reference genotype 1 PsHV-1 strain (Strain 97-0001; GenBank number AY372243) (Fig. 2). Furthermore, KPsHV-1 was clustered together with other previously reported genotype 1 PsHV-1 strains and was distinctly clustered from other genotypes of PsHV-1 strains (Fig. 3). This is the first report for genotype identification of PsHV-1 circulating in Korean psittacine birds. However, considering the global distribution of various genotypes of PsHV-1 and their carriers, it is predicted that all known genotypes of PsHV-1 are already introduced in Korea. Nevertheless, there have been no reports on prevalence and genotype distribution of the virus in the Korean pet parrot population. Therefore, further studies are required to determine the prevalence and genotype distribution of the virus to mitigate the infection risks of the viral infection and to prevent the outbreaks of the disease in pet parrots in Korea.

In conclusion, PsHV-1 infection was confirmed in a Rosella parakeet (Platycercus elegans) raised in an aviary in Korea where many parrots suddenly died in a short period of time. Six dead parrots tested in this study were coinfected with PBFDV, ABV, and/or PsHV-1, suggesting that coinfections with different viral pathogens may be common in Korean psittacine bird populations. Genetic and phylogenetic analyses revealed that KPsHV-1 belongs to genotype 1 PsHV-1, which is the first genotype identification of this virus reported in Korea. Further extensive studies are needed to understand the epidemiology and genetic characteristics of psittacine viruses and to develop control measures for viral infections in pet parrots.

This research was supported by Commercialization of strategic technology research results Program through INNOPOLIS Foundation funded by the Ministry of Science and ICT (grant number, 2024-GJ-RD-0033/project title, Commercialization and industrialization of multi-diagnostic kits for rapid diagnosis of infectious diseases in pet and industrial animals in the Honam region).

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study was conducted in 2024 and was beyond the purview of the Institutional Animal Care and Use Committee (IACUC) at Kyungpook National University (KNU), as the KNU IACUC only evaluates proposals using laboratory animals maintained in indoor facilities and not research involving outdoor animals. Carcasses of dead parrots were directly submitted from the owner of the affected aviary to the Veterinary Diagnostic Laboratory in the College of Veterinary Medicine of Kyungpook National University for etiological diagnosis.

No potential conflict of interest relevant to this article was reported.