Korean Journal of
Veterinary Service

Upper respiratory tract disease (URTD) is a common clinical problem in the global cat population. The primary pathogens associated with the feline URTD include viral pathogens such as feline calicivirus (FCV) and feline herpesvirus type 1 (FHV1) and bacterial pathogens such as Bordetella (B.) bronchiseptica, Chlamydia (C.) felis, and Mycoplasma (M.) felis (Cai et al, 2002; Helps et al, 2005; Di Martino et al, 2007; Lister et al, 2015; Fernandez et al, 2017; Nguyen et al, 2019). B. bronchiseptica is a Gram-negative bacterium of the Alcaligenaceae family that infects the respiratory tract of various mammals and considered to be a primary pathogen of URTD in domestic cats, which is associated with a wide range of respiratory signs from a mild illness with fever, coughing, sneezing, ocular discharge, and lymphadenopathy to severe pneumonia with dyspnea, cyanosis, and death (Helps et al, 2005; Egberink et al, 2009). C. felis (previously C. psittaci var. felis) is a Gram-negative obligate intracellular bacterium of the Chlamydiaceae family, which was first isolated from feline pneumonia (Baker, 1944), and now it is considered as main pathogen of feline conjunctivitis as well as a minor pathogen of feline URTD (Gruffydd-Jones et al, 2009; Sachse and Borel, 2020). M. felis is a cell well defected bacterium of the Mycoplasmataceae family, which has been frequently isolated from the feline conjunctiva as well as respiratory and urogenital tract, and it is strongly suspected as an etiologic agent in feline conjunctivitis, respiratory disease, polyarthritis, and neurological disease (Beauchamp et al, 2011; Le Boedec, 2017). Since these bacteria are common pathogens that cause feline URTD, several conventional polymerase chain reaction (cPCR) and quantitative real-time PCR (qPCR) assays have developed for rapid, sensitive, and specific detection of B. bronchiseptica (Helps et al, 2005; Lovova et al, 2019), C. felis (Everett et al, 1999; Helps et al, 2003; Dean et al, 2005; Pantchev et al, 2010), and M. felis (Chalker et al, 2004; Söderlund et al, 2011). The increased sensitivity and fast turn-around time of the PCR assay makes it the preferred method for bacterial detection in feline clinical samples, and gel-based cPCR assay, which sometimes produced false positive results due to cross-contamination of pre-amplified DNAs, has now largely been replaced by qPCR assay, which is performed in a closed system under stringent quality controls (Helps et al, 2003; Dean et al, 2005; Helps et al, 2005; Pantchev et al, 2010; Söderlund et al, 2011; Lister et al, 2015; Lobova et al, 2019).

Considering that the three bacterial pathogens are widely distributed in the global feline population, and co-infection cases with these bacteria are frequently detected in cats with conjunctivitis and URTD (Fernandez et al, 2017; Lovova et al, 2019; Nguyen et al, 2019; Lee and Park, 2022), it is necessary a more advanced molecular diagnostic assay that can simultaneously and differentially detect these three bacteria in a single reaction. Recently, a triplex qPCR (tqPCR) assay was developed and applied in the simultaneous detection of these three bacteria from feline clinical samples in the Czech Republic (Lovova et al, 2019). However, such a tqPCR assay has not yet been developed and applied in Korea, and some monoplex cPCR or qPCR assays for each bacterial pathogen have been used in diagnosis and prevalence studies (Kang and Park, 2008; Lee and Park, 2022). The aim of this study was to develop a tqPCR assay that can simultaneously and differentially detect these three bacterial pathogens, to evaluate the diagnostic performance of the tqPCR assay with feline clinical samples, and to investigate the prevalence of the bacterial pathogens in the Korean cat populations.

Reference pathogens and samples

B. bronchiseptica (S-55 strain), M. felis (field strain), and C. felis (Baker strain) were used to optimize tqPCR conditions. Other five feline viruses, including FHV1 (593-J strain), FCV (894-T strain), feline leukemia virus (FLV, Rickard strain), feline parvovirus (FPV, Philips Roxane strain), and feline coronavirus (FCoV, WSU 79-1683(3) strain) were obtained from commercially available vaccine company (CAVC) and Animal Disease Intervention Center (ADIC) for evaluating specificity (Table 1). For clinical evaluation of the tqPCR assay, a total of 94 nasopharyngeal samples were obtained from cats with clinical signs of URTD in 2022 through the collaboration of a companion animal health-care company (Postbio Co., Ltd, Guri, Gyeonggi-do, Korea). Total nucleic acids were extracted from 200 uL of a virus stock and clinical samples using a TANBead Nucleic Acid Extraction Kit with a fully automated magnetic bead operating platform (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan), according to the manufacturer’s directions. All samples and total nucleic acids were allocated and stored at −80℃ until use.

Table 1 . Specificity of the triplex quantitative real-time polymerase chain reaction using different feline pathogens and controls.

Pathogen	Strain	Source*	Amplification of target gene†
			Bb (FAM)	Mf (Cy5)	Cf (Texas red)
Bordetella bronchiseptica	S-55	CAVS	+	−	−
Mycoplasma felis	Field strain	ADIC	−	+	−
Chlamydia felis	Baker	CAVS	−	−	+
Feline herpesvirus 1	593-J	CAVS	−	−	−
Feline calicivirus	894-T	CAVS	−	−	−
Feline leukemia virus	Rickard	CAVS	−	−	−
Feline parvovirus	Philips Roxane	CAVS	−	−	−
Feline coronavirus	WSU 79-1683(3)	CAVS	−	−	−
Non-infected feline swab sample	-	ADIC	−	−	−
CRFK cell	-	ADIC	−	−	−
MDCK cell	-	ADIC	−	−	−

*CAVS, commercially available vaccine strain; ADIC, Animal Disease Intervention Center, Kyungpook National University, Korea. †Each probe labeled with (FAM), (Cy5), and Texas red fluorescent dye was detected flaA gene of Bordetella bronchiseptica, (Bb), 16S rRNA gene of Mycoplasma felis (Mf), and ompA gene of Chlamydia felis (Cf), respectively..

+, positive reaction; −, negative reaction..

Primers and probes for the tqPCR assay

Three sets of primers and probes were used for differential detection of B. bronchiseptica, M. felis, and C. felis to establish the tqPCR assay in this study. The primers and probes specific for the major outer membrane protein (ompA) gene of C. felis were taken from previously described qPCR assay (Pantchev et al, 2010). Other two sets of primers and probe for B. bronchiseptica and M. felis were newly designed using Primer Express software (version 3.0) (Applied Biosystems, California, USA) based on the conserved gene sequences of B. bronchiseptica flagellin structural gene (flaA) and M. felis 16S rRNA gene, respectively. To facilitate the establishment of the tqPCR assay, two sets of primers and probe for B. bronchiseptica and M. felis were carefully designed so that their melting temperatures were consistent with those of the previously reported primers and probe set for C. felis. No hairpin, self-dimer, and heterodimer formation between the primers and probes were confirmed using OligoAnalyzer software (IDT, Inc., Skokie, IL, USA). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to determine the specificity of the primers and probes. All primers and probes for three bacteria showed 100% homology with the corresponding bacterial sequences. For the simultaneous and differential detection of three bacterial genes in a single reaction, probes were labeled differently at the 5’ and 3’ ends with 6-carboxyfluorescein (FAM) and black hole quencher 1 (BHQ1) for B. bronchiseptica, cyanine 5 (Cy5) and BHQ3 for M. felis, and Texas red and BHQ1 for C. felis according to the manufacturer’s guidelines (BIONICS, Daejeon, Korea) (Table 2).

Table 2 . Primers and probes for the triplex quantitative real-time polymerase chain reaction in this study.

Pathogen/gene*	Primer/probe	Sequence (5’–3’)*	Tm (℃)	Amplicon (base-pairs)	Reference
Bb/flaA	Bb-F	GAACTCGGCTTCGGACATC	62.1	111	This study
	Bb-R	CGTTGGACTTCAGGACCTTG	62.3
	Bb-P	FAM-TCTGCTCGGCGATGCGGTTGATTTC-BHQ1	70.4
Mf/16S rRNA	Mf-F	GGCGAATGGGTGAGTAAC	59.9	74	This study
	Mf-R	GTATCCGGCATTAGCGATAAT	60.1
	Mf-P	Cy5-ACGTACCTTTTAGTTTGGAATAACGGTGAG-BHQ3	66.7
Cf/ompA	Cf-F	TCGGATTGATTGGTCTTGCA	62.1	78	Pantchev et al. (2010)
	Cf-R	GCTCTACAATGCCTTGAGAAATTTC	62.6
	Cf-P	Texas red-ACTGATTTCGCCAATCAGCGTCCAA-BHQ2	68.7

*Primers and probes of the assays were designed based on the sequences of Bordetella bronchiseptica (Bb) flagellin structural gene (flaA), Mycoplasma felis (Mf) 16S rRNA gene, and Chlamydia felis (Cf) major outer membrane protein gene (ompA), respectively..

Construction of DNA standards

Plasmids containing the target genes of the B. bronchiseptica (flaA), M. felis (16S rRNA), and C. felis (ompA) were constructed and used as DNA standards for evaluation of the assay’s sensitivity and accuracy in this study. Each target gene of three bacteria was amplified with primers for B. bronchiseptica (Bb-F and Bb-R), M. felis (MF-F and Mf-R), or C. felis (Cf-F and Cf-R) using DNA templates extracted from reference strains described above by a commercial PCR kit (PrimeSTAR^® GXL DNA Polymerase; Takara, Shiga, Japan), according to the manufacturer’s instructions. The amplified products were purified and cloned into pTOP TA V2 vector (TOPcloner™ TA core Kit; Enzynomics, Korea) and transformed into Escherichia coli competent cells according to the manufacturer’s instructions (DH5α chemically competent E. coli; Enzynomics, Korea). Each plasmid containing the target gene of B. bronchiseptica, M. felis, or C. felis was purified using a commercial kit (GeneAll Expin Combo GP 200 miniprep kit, GeneAll, Seoul, Korea). DNA concentration of each plasmid was determined by measuring the absorbance at 260 nm using a NanoDrop Lite instrument (Thermo Scientific, Waltham, MA, USA), and the copy number of each cloned gene was quantified as previously described (Kim et al, 2022). The standard DNA samples were serially diluted 10-fold (from 10⁶ to 10⁰ copies/reaction) and stored at −80℃ until use.

Optimization of the tqPCR conditions

Before optimization of the tqPCR conditions, each monoplex qPCR using B. bronchiseptica, M. felis, or C. felis-specific primers and probe set was carried out using a commercial qPCR kit (RealHelix™ qPCR kit Probe, NanoHelix, Daejeon, Korea) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA). To optimize the tqPCR conditions, the concentrations of three sets of primers and probe were optimized, whereas the other reaction components were maintained at the same concentrations used in the monoplex reactions. The monoplex qPCR and tqPCR cycling programs were comprised the steps 15 min at 95℃ for initial denaturation, followed by 40 cycles at 95℃ for 20 s and 60℃ for 40 s for amplification. Fluorescence signals from FAM, Cy5, and Texas red were detected at the end of each annealing step. To interpret the monoplex and tqPCR results, samples that produced a cycle threshold (Ct) of less than 37 were considered positive, whereas those with a higher Ct value (>37) were considered negative, according to previously described guidelines (Broeders et al, 2014).

Specificity and sensitivity of the tqPCR assay

To evaluate the assay’s specificity, the tqPCR was performed with total nucleic acids extracted from eight feline pathogens (B. bronchiseptica, M. felis, C. felis, FHV1, FCV, FLV, FPV, and FCoV), and a non-infected feline nasopharyngeal swab sample and two non-infected cultured cells (CRFK and MDCK cells) of feline and canine-origin as negative controls. The sensitivities of the tqPCR and its corresponding monoplex qPCR assays were determined in triplicate using serial dilutions (from 10⁶ to 10⁰ copies/reaction) of each standard plasmid DNA containing the target genes of three bacteria mentioned above. For data analysis, CFX96 Touch Real-Time PCR detection software (Bio-Rad) was used to create a standard curve with the threshold cycle (Ct) values of each 10-fold dilution of the standard DNA samples (from 10⁶ to 10⁰ copies/reaction). The detection software calculated the correlation coefficient (R²) of the standard curve, standard deviations, and the copy numbers of B. bronchiseptica, M. felis, and C. felis DNAs of the samples based on the standard curves.

Precision of the tqPCR assay

Repeatability (intra-assay precision) and reproducibility (inter-assay precision) of the tqPCR assay for B. bronchiseeptica, M. felis, and C. felis were determined using three different concentrations of the bacterial DNA standards. The concentrations of standard DNAs for B. bronchiseptica, M. felis, and C. felis were 10⁶, 10⁴, and 10² copies/reaction (high, medium, and low), respectively. For intra-assay variability, each dilution was analyzed in triplicate on the same day, whereas for inter-assay variability, each dilution was analyzed in six independent experiments performed by two different operators on different days according to the MIQE guidelines (Bustin et al, 2009). The coefficient of variation for Ct values was determined based on the intra- or inter-assay results.

Reference qPCR assays

Previously described monoplex qPCR assays for B. bronchiseptica (Tizolova et al, 2014), M. felis (Lobova et al, 2019), and C. felis (Pantchev et al, 2010) were adopted as reference qPCR assays since these monoplex qPCR assays target the same genes as the tqPCR assay to be established in this study. The monoplex qPCR assays with B. bronchiseptica flaA gene-specific primers (Fla2 and Fla12) and probe (Fla-FAM3), M. felis 16S rRNA gene-specific primers (M. felis For and M. felis Rev) and probe (M. felis probe), and C. felis ompA gene-specific primers (CpfOMP1-F and CpfOMP1-R) and probe (CpfOMP1-S) using a commercial qPCR kit (NanoHelix) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad) as previously described reaction conditions (Pantchev et al, 2010; Tizolova et al, 2014; Lobova et al, 2019). To interpret these monoplex qPCR results, samples that produced a cycle threshold (Ct) of less than 37 were considered positive after 40 amplification cycles, whereas those with a higher Ct value (>37) were considered negative, according to the same criteria as the tqPCR assay.

Clinical application of the tqPCR assay

To evaluate the diagnostic performance of the tqPCR assay for differential detection of B. bronchiseptica, M. felis, and C. felis, 94 feline clinical samples were tested by the newly developed tqPCR assay, and the results were compared with those of each monoplex qPCR assay for B. bronchiseptica (Tizolova et al, 2014), M. felis (Lobova et al, 2019), or C. felis (Pantchev et al, 2010). The diagnostic concordance between the tqPCR and each monoplex qPCR was determined using Cohen’s kappa statistics at a 95% confidence interval (CI) (Kwiecien et al, 2011). Given a calculated kappa coefficient value of 0.81–1.0, the results from these assays were almost 100% concordant. Furthermore, the prevalence and co-infection status of B. bronchiseptica, M. felis, and C. felis in Korean domestic cats were analyzed based on the tqPCR results for the tested clinical samples.

Optimal conditions of the tqPCR assay

For simultaneous and differential detection of B. bronchiseptica, M. felis, and C. felis in a single reaction, the concentrations of primers and probes were optimized under the same qPCR conditions in a triplex format. The tqPCR using the optimized concentrations of primer and probes (0.25 μM of primers and 0.25 μM of probes for B. bronchiseptica, M. felis, and C. felis) simultaneously detected the fluorescent signals of FAM, Cy5, and Texas red (Fig. 1A, 1C, 1E, and 1F). The standard curves for monoplex qPCR or tqPCR assays revealed a linear relationship between the log copy number and Ct value; the correlation coefficient (R²) over the entire concentration range was determined to be >0.99 for each monoplex qPCR and tqPCR assays, demonstrating that the developed tqPCR assay is highly quantitative (Fig. 1B, 1D, 1F, and 1H). Therefore, the newly developed tqPCR assay can quantitatively amplify the three target genes of B. bronchiseptica, M. felis, and C. felis in a single reaction without spurious amplification or significant crosstalk between the three fluorescent reporter dyes (Fig. 1).

Figure 1. Sensitivities and standard curves of monoplex and triplex real-time polymerase chain reaction (qPCR) assays for B. bronchiseptica, M. felis, and C. felis. (A, B) monoplex qPCR for B. bronchiseptica; (C, D) monoplex qPCR for M. felis; (E, F) monoplex qPCR for C. felis; (G, H) triplex qPCR for B. bronchiseptica, M. felis, and C. felis. Sensitivities of each monoplex qPCR and triplex qPCR were determined using 10-fold serial dilutions of each bacterial DNA standard (10⁶ to 10⁰ copies/reaction, lines 6∼0). Standard curves were generated from the results of monoplex and triplex qPCR assays using 10-fold serial dilutions of each bacterial DNA standard in triplicate. Serial 10-fold dilutions of viral DNA standard (10⁶ to 10⁰ copies/reaction) were plotted against the threshold cycle (Ct). The correlation coefficient value (R²) and the equation of the regression curve (y) were calculated using CFX Maestro software (Bio-Rad). NC, negative control.

Specificity and sensitivity of the tqPCR assay

Each set of primers and probe for B. bronchiseptica, M. felis, or C. felis specifically amplified the target DNA of the respective bacteria only, and no positive results were obtained for any of the other feline pathogens, non-infected feline swab sample, and two culture cells (Table 2). As expected, the target genes of three bacteria were co-amplified using the tqPCR assay from a mixed DNA sample of B. bronchiseptica, M. felis, and C. felis DNAs (Fig. 1G). These results indicate that the tqPCR assay was highly specific and can be applied for differential detection of B. bronchiseptica, M. felis, and C. felis in a single reaction. The limit of detection for the tqPCR assay was below 10 copies/reaction of the target genes for B. bronchiseptica (flaA), M. felis (16S rRNA), and C. felis (ompA), which were equivalent with those of the monoplex qPCR assays (Fig. 1).

Precision of the tqPCR assay

To assess the intra-assay repeatability and inter-assay reproducibility of the tqPCR, three different concentrations of each bacterial standard DNAs were tested in triplicate on six different runs performed by two different operators on different days (Bustin et al, 2009). The coefficients of variation within runs (intra-assay variability) were 0.20% to 0.45% for B. bronchiseptica, 0.29% to 0.69% for M. felis, and 0.31% to 0.49% for C. felis, respectively. The inter-assay variabilities were 0.26% to 0.55% for B. bronchiseptica, 0.66% to 0.83% for M. felis, and 0.33% to 0.82% for C. felis, respectively (Table 3). Therefore, the assay showed high repeatability and reproducibility, with coefficients of intra-assay and inter-assay variation of less than 1%. These results indicate that the tqPCR assay developed in this study can be used as an accurate and reliable diagnostic tool for differentially detecting B. bronchiseptica, M. felis, and C. felis (Broeders et al, 2014).

Table 3 . Intra- and inter-assay coefficient of variation of the triplex real-time polymerase chain reaction for Bordetella bronchiseptica, Mycoplasma felis, Chlamydia felis.

Pathogen	Dilution (copies/reaction)	Intra-assay variability				Inter-assay variability
		Mean	SD	CV (%)		Mean	SD	CV (%)
B. bronchiseptica	High (106)	21.41	0.10	0.45		21.38	0.10	0.46
	Medium (104)	27.04	0.05	0.20		27.02	0.07	0.26
	Low (102)	34.08	0.15	0.44		34.21	0.19	0.55
M. felis	High (106)	20.95	0.06	0.29		20.86	0.17	0.83
	Medium (104)	28.00	0.13	0.48		27.85	0.18	0.66
	Low (102)	34.66	0.24	0.69		34.49	0.26	0.77
C. felis	High (106)	21.86	0.11	0.49		21.75	0.18	0.82
	Medium (104)	28.02	0.09	0.31		27.92	0.14	0.50
	Low (102)	35.07	0.12	0.34		35.12	0.12	0.33

The mean value, standard deviation (SD), and coefficient of variation (CV) were determined based on the Ct values for the tqPCR assay..

Clinical application of the tqPCR assay

For clinical evaluation of the newly developed tqPCR assay and investigation of prevalence and co-infection status of B. bronchiseptica, M. felis, and C. felis in the Korean cat population, 94 feline clinical samples were tested using the tqPCR and previously described monoplex qPCR assays for B. bronchiseptica, M. felis, and C. felis (Lobova et al, 2019; Pantchev et al, 2010; Tizolova et al, 2014). The detection rates for B. bronchiseptica, M. felis, and C. felis were 10.6% (10/94), 36.2% (34/94), and 6.4% (6/94), respectively, using the newly developed tqPCR assay (Table 4). The detection rates of B. bronchiseptica and C. felis were consistent with those of the previously described monoplex qPCR assays, indicating that diagnostic results of the tqPCR were 100% concordant with the previously described qPCR assays for B. bronchiseptica and C. felis. However, the tqPCR assay failed to detect one clinical sample that tested M. felis positive by the previously described Lovova’s qPCR assay with Ct value of 35.8, and as a result, the detection rate of M. felis by the tqPCR was slightly lower than that of the previously described monoplex qPCR assay (37.2%, 35/94), showing that the concordance between assays was 98.9% for M. felis. These results demonstrate that the newly developed tqPCR assay will be applicable for simultaneous and differential diagnosis of B. bronchiseptica, M. felis, and C. felis in field samples.

Table 4 . Comparison of diagnostic results between the newly triplex real-time polymerase chain reaction (tqPCR) and previous qPCR assays for detection of B. bronchiseptica, M. felis, and C. felis from 94 feline clinical samples.

Methods	Pathogen	No. of tested	No. of positive	Detection rate (%)†
New tqPCR	B. bronchiseptica	94	10	10.6
	M. felis	94	34	36.2
	C. felis	94	6	6.4
Previous qPCR	B. bronchiseptica	94	10	10.6
	M. felis	94	35*	37.2
	C. felis	94	6	6.4

*One clinical sample that was tested M. felis negative by the tqPCR assay was determined as M. felis positive by the previously described qPCR assay with Ct value of 35.8..

^†The positive, negative, and overall agreements between the developed tqPCR and previously described qPCR assays were 100% for B. bronchiseptica and C. felis, and was 100%, 98.3%, 98.9% for M. felis, respectively..

Based on the clinical diagnostic results of the tqPCR assay, prevalence of B. bronchiseptica, M. felis, or C. felis in 94 clinical samples tested was 10.6%, 36.2%, and 6.4%, respectively (Table 4). The co-infection analysis of clinical samples indicated that the single infection rates for B. bronchiseptica, M. felis, or C. felis were 8.5% (8/94), 30.9% (29/94), and 3.2% (3/94), respectively. The dual infection rates for B. bronchiseptica and M. felis or M. felis and C. felis was 2.1% (2/94) or 3.2% (3/94), respectively. The dual infection with B. bronchiseptica and C. felis and triple infection with B. bronchiseptica, M. felis and C. felis were not determined in this study (Fig. 2). These results indicated that M. felis has been widely spread, and its co-infections with B. bronchiseptica or M. felis have been frequently occurred in Korean cat population.

Figure 2. Prevalence and co-infection status for B. bronchiseptica, M. felis, and C. felis determined using the newly developed triplex real-time PCR assay with 94 clinical samples collected from household cats with upper respiratory tract disease.

Feline URTD is considered as a multifactorial disease that caused by multiple viral and bacterial pathogens, including FCV, FHV1, B. bronchiseptica, C. felis, and M. felis (Helps et al, 2005; Lister et al, 2015; Fernandez et al, 2017; Nguyen et al, 2019). Since the incidence and prevalence of the various pathogens associated with URTD varies widely, the etiological and epidemiological information on URTD outbreaks in the domestic cat population is essential for the effective management and control of feline URTD in their own country. However, although numerous studies have been conducted worldwide, there have been few studies for the etiology and epidemiology of feline URTD in Korea (Kang and Park, 2008; Lee and Park, 2022). Therefore, in the present study, we developed and evaluated a tqPCR assay that can simultaneously and differentially detect three main bacterial pathogens associated with feline URTD and investigated the prevalence and co-infection status of these three bacterial pathogens in the Korean cat populations using the newly developed tqPCR assay.

The developed tqPCR assay in this study have some advantages. The tqPCR assay can specifically and differentially detect three main bacterial pathogens associated with feline URTD in a single reaction without any cross-reactivity with other feline pathogens (Table 1 and Fig. 1). Although several qPCR assays have been described for the detection of these bacterial pathogens in a monoplex format (Dean et al, 2005; Helps et al, 2005; Pantchev et al, 2010; Söderlund et al, 2011; Tizolova et al, 2014) or in a multiplex format such as duplex qPCR for C. felis and FHV1 (Helps et al, 2003), triplex qPCR for FCV, FHV1, and feline parvovirus (Cao et al, 2022), or another triplex qPCR for FHV, FCV, and C. felis (Helps et al, 2005). However, the tqPCR assay that can simultaneously and differentially detect B. bronchiseptica, M. felis, and C. felis was only one described by Lavova et al. (2019). The Lavova’s tqPCR assay was used for the surveillance of the bacterial pathogens in the Czech Republic, but the analytical sensitivity and clinical diagnostic performance of the assay were not fully validated by comparing with the well-established qPCR assays previously described. Therefore, we newly developed a tqPCR assay that can differentially detect B. bronchiseptica, M. felis, and C. felis in a reaction and evaluated the analytical sensitivity and clinical diagnostic performance in this study. The sensitivity of the newly developed tqPCR was determined as below 10 copies/reaction with standard DNAs of B. bronchiseptica, M. felis, and C. felis, respectively, which was equivalent with those of the corresponding monoplex assays previously described (Fig. 1). Furthermore, in the clinical evaluation with feline clinical samples, the tqPCR assay showed that the diagnostic sensitivity was comparable to those of previously described monoplex qPCR assays for B. bronchiseptica (Tizolova et al, 2014), M. felis (Lobova et al, 2019), and C. felis (Pantchev et al, 2010) as shown in Table 4. It was worth noting that it is not easy to collect a large volume of clinical samples from small companion animals such as pet cats. Therefore, sample-saving methodology is needed to perform various laboratory tests using a small amount of sample collected from a diseased cat. In this respect, the developed tqPCR assay is more desirable because it can simultaneously detect three bacterial pathogens in a reaction with the same DNA template, which made it saves clinical sample as well as saves time and resources in feline disease diagnostic laboratories or animal hospitals. Taken together, all these results suggested that the newly developed tqPCR assay can be applied for the clinical diagnosis of three main bacterial pathogens and will be a powerful tool for etiological and epidemiological studies for feline URTD in the future.

Given the global epidemiological situation of feline URTD, it is presumed that the main pathogens associated with URTD are already widely prevalent in the Korean cat population. Nevertheless, there have been few reports on the prevalence of URTD pathogens in the Korean cat population. A prevalence study was carried out in 78 cats without clinical signs of URTD housed in a Korean animal shelter in 2008, and the prevalence of FHV1 was 63%, but all tested cats were negative for FCV and C. felis (Kang and Park, 2008). Another recent prevalence study was based on 100 clinical samples collected from cats that visited an animal medical center located in Seoul, Korea, and the prevalence of M. felis was determined as 42%, the highest among the investigated bacterial pathogens, followed by B. bronchiseptica (4.3%) and C. felis (2.9%) (Lee and Park, 2022). In this study, the prevalence of M. felis (36.2%) was higher than those of B. bronchiseptica (10.6%) and C. felis (6.4%), which were similar to that of the previous report in Korea (Lee and Park, 2022). The reported global prevalence of the feline URTD pathogens varied according to the investigated countries, cat populations, and diagnostic assays used in those studies (Cai et al, 2002; Helps et al, 2005; Litster et al, 2015; Fernandez et al, 2017). Therefore, further extensive studies are needed to determine the prevalence of URTD pathogens in the various cat populations in Korea. On the other hand, it is worth noting that cases of co-infection with M. felis and B. bronchiseptica or C. felis were detected along with the high prevalence of M. felis in this study (Fig. 2), and such co-infection with M. felis and other respiratory pathogens were reported in several previous studies (Fernandez et al, 2017; Lovova et al, 2019; Nguyen et al, 2019; Lee and Park, 2022). The co-infection with mycoplasma and other respiratory pathogens shortened the incubation period, worsened the disease, and led to more severe macroscopic and microscopic lesions compared to these parameters in animals infected with only one pathogen (Cohn, 2011; Lee-Fowler, 2014; Fernandez et al, 2019; Lion et al, 2021). Therefore, further studies are needed to elucidate the impacts of co-infections on the pathogenesis and clinical outcomes of co-infected cats in the field.

The present study has some limitations. First. since this study aimed to the development of the tqPCR assay for three main bacteria associated with feline URTD and to investigate their prevalence, major viral pathogens involved in the disease were not included in the scope of the study. Second, clinical samples used in this study were collected from household cats that visited to animal clinics but not from animal shelters that should be included in the prevalence study of URTD in the Korean cat population. Therefore, further studies are required to develop more advanced diagnostic assays for feline pathogens associated with URTD and to investigate prevalence in more expanded cat populations in the future.

In conclusion, we successfully developed a highly specific, sensitive, and reliable tqPCR assay that can differentially detect three main bacterial pathogens associated with feline URTD (B. bronchiseptica, M. felis, and C. felis) in a single reaction. Based on the clinical diagnostic results of the assay, the prevalence and co-infection status of these three bacterial pathogens were determined in Korean cat populations. The developed tqPCR assay will be a promising tool for etiological and epidemiological studies of these three feline bacterial pathogens. The prevalence data obtained in this study will contribute to expanding knowledge about the epidemiology of feline URTD in Korea.

This work was supported by the fund (Z-15430852022- 23-03) by the Animal and Plant Quarantine Agency, Korea.

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study was conducted in 2022 and was beyond the purview of the Institutional Animal Care and Use Committee (IACUC) at Kyungpook National University (KNU), as the KNU IACUC only evaluates proposals using laboratory animals maintained in indoor facilities and not research involving outdoor animals. Canine and feline clinical samples were collected by practicing veterinarians at local clinics and animal shelters during monitoring, surveillance, and treatment, or during regular medical check-ups, after receiving verbal consent from the owners.

No potential conflict of interest relevant to this article was reported.