Top

Original Article

Split Viewer

Korean J. Vet. Serv. 2022; 45(2): 87-99

Published online June 30, 2022

https://doi.org/10.7853/kjvs.2022.45.2.87

© The Korean Socitety of Veterinary Service

Prevalence and co-infection status of three pathogenic porcine circoviruses (PCV2, PCV3, and PCV4) by a newly established triplex real-time polymerase chain reaction assay

Hye-Ryung Kim 1, Jonghyun Park 1,2, Won-Il Kim 3, Young S. Lyoo 4, Choi-Kyu Park 1*

1College of Veterinary Medicine & Animal Disease Intervention Center, Kyungpook National University, Daegu 41566, Korea
2DIVA Bio Inc., Daegu 41519, Korea
3College of Veterinary Medicine, Jeonbuk National University, Iksan 54596, Korea
4College of Veterinary Medicine, Konkuk University, Seoul 05029, Korea

Correspondence to : Choi-Kyu Park
E-mail: parkck@knu.ac.kr
https://orcid.org/0000-0002-0784-9061

Received: June 7, 2022; Accepted: June 12, 2022

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

A novel porcine circovirus 4 (PCV4) was recently emerged in Chinese and Korean pig herds, which provided epidemiological situation where three pathogenic PCVs, PCV2, PCV3, and newly emerged PCV4, could co-infect pig herds in these countries. In this study, a new triplex quantitative real-time polymerase chain reaction (tqPCR) method was developed for the rapid and differential detection of these viruses. The assay specifically amplified each viral capsid gene, whereas no other porcine pathogenic genes were detected. The detection limit of the assay was below 10 copies/μL and the assay showed high repeatability and reproducibility. In the clinical evaluation using 1476 clinical samples from 198 Korean pig farms, the detection rates of PCV2, PCV3 and PCV4 by the tqPCR assay were 13.8%, 25.4%, and 3.8%, respectively, which were 100% agreement with those of previously reported monoplex qPCR assays for PCV2, PCV3, and PCV4, with a κ value (95% CI) of 1 (1.00∼1.00). The prevalence of PCV2, PCV3, and PCV4 at the farm levels were 46.5%, 63.6%, and 19.7%, respectively. The co-infection analysis for tested pig farms showed that single infection rates for PCV2, PCV3, and PCV4 were 28.8%, 44.4%, and 9.6%, respectively, the dual infection rates of PCV2 and PCV3, PCV2 and PCV4, and PCV3 and PCV4 were 12.6%, 3.5%, and 5.1%, respectively, and the triple infection rate for PCV2, PCV3, and PCV4 was 1.5%. These results demonstrate that three pathogenic PCVs are widely spread, and their co-infections are common in Korean pig herds, and the newly developed tqPCR assay will be useful for etiological and epidemiological studies of these pathogenic PCVs.

Keywords Differential diagnosis, Porcine circoviruses, Triplex real-time PCR

Circoviruses are small non-enveloped DNA viruses containing a single circular, covalently closed, and single-stranded genome, which belongs to the genus Circovirus of the family Circoviridae (Rosario et al, 2017). To date, four species of circoviruses that infect pigs have been identified: porcine circovirus (PCV) type 1 (PCV1), type 2 (PCV2), type 3 (PCV3), and type 4 (PCV4). PCV1 was first recognized as a contaminant of the continuous porcine kidney cell line PK-15 (ATCC-CCL31) and subsequently determined to be nonpathogenic to pigs (Tischer et al, 1982). In contrast, PCV2, identified in diseased pigs in the early 1990s, is now considered a major disease-causing pathogen leading to an immense economic loss in the global swine industry (Opriessnig et al, 2007; Segalés, 2012). The clinical manifestations of PCV2 infections are collectively termed PCV-associated disease (PCVAD), characterized by several clinical conditions, including post-weaning multisystemic wasting syndrome (PMWS), porcine dermatitis, and nephropathy syndrome (PDNS), reproductive disorders, enteritis, proliferative and necrotizing pneumonia, and porcine respiratory disease complex (PRDC). In 2015, a third PCV species, PCV3, was discovered, in the USA, in pigs with PDNS, reproductive failure, myocarditis, and multisystemic inflammation (Phan et al, 2016; Palinski et al, 2017). Since then, PCV3 has been globally identified in pigs with various clinical symptoms consistent with those of PCVAD in several countries, including South America (Tochetto et al, 2018; Saraiva et al, 2019), Europe (Stadejek et al, 2017; Fux et al, 2018; Klaumann et al, 2019), and Asia, particularly China (Ku et al, 2017), and Korea (Kim et al, 2017; Kwon et al, 2017; Park et al, 2018; Kim et al, 2020). More recently, in 2019, a fourth novel and genetically distinct PCV, designated PCV4, was discovered in pigs with PDNS-like clinical syndrome in Hunan province, China (Zhang et al, 2020b). PCV4 infection was further confirmed in diseased and healthy pigs in other provinces in China (Zhang et al, 2020a; Sun et al, 2021; Tian et al, 2021) and Korea (Nguyen et al, 2021; Kim et al, 2022a; Kim et al, 2022b). Since PCV4 is difficult to isolate in vitro using cell culture (Zhang et al, 2020b), molecular diagnostic assays, such as conventional and real-time PCR, are currently used to detect PCV4 in clinical samples. Conventional PCR and quantitative real-time PCR (qPCR) are used for the routine diagnosis of PCV4 because of their high specificity, sensitivity, and ability to detect and differentiate multiple targets simultaneously (Zhang et al, 2020a; Chen et al, 2021; Hou et al, 2021; Tian et al, 2021; Chen et al, 2022; Kim et al, 2022b). The clinical manifestations of PCV3 and PCV4 are similar to those of PCV2, and co-infection with PCV2, PCV3, and PCV4 has been confirmed in pig populations. Therefore, a rapid and reliable diagnostic assay is required for the differential detection of PCV2, PCV3, and PCV4 in the field (Kim et al, 2017; Zhang et al, 2020a; Chen et al, 2021; Sun et al, 2021; Kim et al, 2022b). Several multiplex qPCR (mqPCR) assays have been developed for the simultaneous detection of different types of PCVs, such as duplex qPCR for PCV2 and PCV3 (Kim et al, 2017; Li et al, 2018; Wang et al, 2019); PCV3 and PCV4 (Hou et al, 2021); triplex qPCR for PCV1, PCV2, and PCV3 (Yang et al, 2019); and quadruplex qPCR for PCV1, PCV2, PCV3, and PCV4 (Chen et al, 2021). However, considering the pathogenicity and clinical significance of PCV2, PCV3, and PCV4 in pigs, a new mqPCR method is necessary for differential detection of these three pathogenic PCVs in clinical pig samples. Therefore, in this study, we developed a new triplex qPCR (tqPCR) assay capable of detecting and typing PCV2, PCV3, and PCV4 and evaluated its diagnostic potential using pig samples to investigate the prevalence and co-infection status of the three pathogenic PCVs in Korean pig farms.

Viruses and samples

PCV2 (PCK0201 strain) (Park et al, 2004), PCV3 (PCK3- 1701 strain) (Kim et al, 2017), and PCV4 (PCV4-K2101 strain) (Kim et al, 2022a) Korean field strains were used to optimize tqPCR conditions. Other porcine viral pathogens, including PCV1 (from infected PK-15 cell culture), type 1 porcine reproductive and respiratory syndrome virus (PRRSV, Lelystad virus), type 2 PRRSV (LMY strain), classical swine fever virus (CSFV, LOM strain), and porcine parvovirus (PPV, NADL-2 strain) were obtained from the Animal and Plant Quarantine Agency and Animal Disease Intervention Center for evaluating specificity. All pathogen samples were stored at −80℃ until use. For clinical evaluation of the tqPCR assay and investigation of prevalence and co-infection status of PCVs, 1476 clinical samples (tissue, serum, or oral fluid) were collected from 198 domestic pig farms that had experienced outbreaks of respiratory and systemic diseases during 2019 and 2020. The tissue samples were homogenized and diluted 10-fold with phosphate-buffered saline (0.1 M, pH 7.4). All samples were frozen and thawed twice, vortexed for 5 min, and centrifuged at 10,000×g (Hanil, Republic of Korea) for 10 min at 4℃. Viral DNA and RNA were extracted from 200 μL of virus stocks and field samples using a TANBead nucleic acid extraction kit with a fully automated magnetic bead operating platform (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan) and eluted into 100 μL of elution buffer, according to the manufacturer’s instructions. For RNA viruses, total RNA was reverse transcribed to cDNA using the Primescript™ 1st strand cDNA synthesis kit (Takara Korea Biomedical Inc., Seoul, Republic of Korea), according to the manufacturer’s instructions. All nucleic acid samples were stored at −80℃.

Construction of DNA standards

Plasmids containing the complete capsid genes of the PCV2 PCK0201 and PCV3 PCK3-1701 strains (GenBank accession numbers MF964236 and MF611876, respectively) were used as DNA standards for PCV2 and PCV3, respectively, as previously reported (Kim et al, 2017). For PCV4, the complete capsid gene was amplified by PCR from a Korean PCV4 strain (PCV4-K2101, GenBank accession number MZ436811) using specific primers (PCV4-1038F 5′-CACTACGCATTATCCCTGTTTG-3′ and PCV4-1741R 5′-ACCCACAGATGCCAATCAGA-3′). PCR was carried out using a commercial kit (PrimeSTAR® GXL DNA Polymerase; Takara, Shiga, Japan) in 50 μL reaction mixtures containing 10 μL of 5X PrimeSTAR GXL buffer, 4 μL of dNTP mixture, 1 μL of PrimeSTAR GXL DNA polymerase, 0.2 μM of each primer, and 5 μL of PCV4 DNA as a template, according to the manufacturer’s instructions. Amplification was carried out using a thermal cycler (Applied Biosystems, USA) under the following conditions: initial denaturation at 98℃ for 1 min, 35 cycles of amplification (10 s at 98℃, 15 s at 55℃, and 2 min at 68℃), and a final extension at 68℃ for 7 min. The amplified product was purified and cloned into pTOP TA V2 vector (TOPcloner™ TA core Kit; Enzynomics, Korea) and transformed into Escherichia coli competent cells according to the manufacturer’s instructions (DH5α chemically competent E. coli; Enzynomics, Republic of Korea). Each plasmid containing the PCV2, PCV3, and PCV4 capsid genes was purified using a commercial kit (GeneAll Expin Combo GP 200 miniprep kit, GeneAll, Seoul, Republic of Korea). DNA concentration of each plasmid was determined by measuring the absorbance at 260 nm using a NanoDrop Lite instrument (Thermo Scientific, Waltham, MA, USA), and the copy number of each cloned gene was quantified as previously described (Kim et al, 2017). PCV2, PCV3, and PCV4 standard DNA samples were serially diluted by 10-fold (from 106 to 100 copies/μL), stored at −80℃, and used as standards for viral DNA quantitation of diagnostic samples.

Primers and probes for tqPCR assay

Three sets of primers and probes were used for differential detection of PCV2, PCV3, and PCV4 to establish the tqPCR assay. The primers and probes specific for capsid genes of PCV2 and PCV3 were taken from previously well-established duplex qPCR assays for simultaneous detection of PCV2 and PCV3 (Kim et al, 2017). The PCV4-specific primers and probe were newly designed using Primer Express software (version 3.0) (Applied Biosystems) based on 49 PCV4 genome sequences, including 47 Chinese and two Korean strains, available at the National Center for Biotechnology Information. To facilitate the establishment of tqPCR, the primers and probe for PCV4 were carefully designed so that their melting temperatures were consistent with those of the previously reported primers and probes for PCV2 and PCV3. No hairpin, self-dimer, or heterodimer formation between the primers and probes for PCV2, PCV3, and PCV4 were confirmed using OligoAnalyzer software (IDT, Inc., Skokie, IL, USA). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to determine the specificity of the primers and probes. Each primer and probe for PCV2, PCV3, and PCV4 showed 100% homology with the corresponding virus sequences. Furthermore, we evaluated the specificity of the qPCR assay using each primer/probe set in silico using FastPCR software, version 5.4 (PrimerDigital Ltd., Finland) following the developer’s instructions (Kalendar et al, 2011). The predictive success rate of the tqPCR with each primer/probe set was 99.4% (1870/1882) for PCV2, 100% (111/111) for PCV3, and 100% (49/49) for PCV4, showing that each tqPCR assay with the selected primer/probe sets was highly specific and could be applied to amplify PCV2, PCV3, or PCV4 capsid genes. For accurate differential detection of PCV2, PCV3, and PCV4 by tqPCR, sequence-specific probes should be labeled with reporter dyes, the fluorescence spectra of which are distinct or show only minimal overlap (Navarro et al, 2015). In this study, for the simultaneous and differential detection of capsid genes of PCV2, PCV3, and PCV4 in a single reaction, probes were labeled differently at the 5′ and 3′ ends with 6-carboxyfluorescein (FAM) and black hole quencher (BHQ) 1 for PCV2, 6-carboxy-X-rhodamine (ROX) and BHQ 2 for PCV3, and cyanine 5 (Cy5) and BHQ 2 for PCV4, according to the manufacturer’s guidelines (BIONICS, Daejeon, Republic of Korea) (Table 1).

Table 1 . Primers and probes for the triplex quantitative real-time polymerase chain reaction assay in this study

VirusPrimer/probeSequence (5′-3′)*PositionTm (℃)Amplicon (base pairs)Reference
PCV2PCV2FCCAGGAGGGCGTTSTGACT1534∼155261.399Kim et al (2017)
PCV2RCGYTACCGYTGGAGAAGGAA1613∼163258.3
PCV2PFAM-AATGGCATCTTCAACACCCGCCTCT-BHQ11587∼161168.0
PCV3PCV3FCGGTGGGGTCATATGTGTTG1443∼146262.5118Kim et al (2017)
PCV3RCACAGCCGTTACTTCACC1543∼156060
PCV3PROX-CTTTGTCCTGGGTGAGCGCTGGTAG-BHQ21496∼152069.6
PCV4PCV4FTAGTGGCAGAAATTCGACTT1425∼144459.5100In this study
PCV4RGGACTTTATCCCAAAAGGAC1505∼152458.1
PCV4PCy5-CCGGTAATATGCAAATGGGAGGCTG-BHQ21458∼148266.7

*Bold text in sequences of PCV2F and PCV2R primers represent a degenerative base: S, C, or G; Y, C, or T, respectively.

Genome position of primer- and probe-binding sites were derived from the complete genome sequence of PCV2 PCK0201 strain (MF964236), PCV3 PCK3-1701 strain (MF611876), and PCV4 AHG-2019 strain (MK986820).

PCV, porcine circoviruses.



Optimization of tqPCR conditions

Before optimization of the tqPCR conditions, each monoplex qPCR assay using PCV2-, PCV3-, or PCV4-specific primers and probe set was carried out using a commercial qPCR kit (RealHelix™ qPCR kit Probe, NanoHelix, Daejeon, Korea) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA). To optimize the tqPCR conditions, the concentrations of three sets of each primer and probe were optimized, whereas the other reaction components were maintained at the same concentrations used in the monoplex reactions. The monoplex qPCR and tqPCR cycling programs were the same and comprised the steps 15 min at 95℃ for initial denaturation, followed by 40 cycles at 95℃ for 20 s and 60℃ for 40 s for amplification. Fluorescence signals from FAM, ROX, and Cy5 were detected at the end of each annealing step. To interpret the monoplex and tqPCR results, samples that produced a cycle threshold (Ct) of less than 40 were considered positive, whereas those with a higher Ct value (>40) were considered negative, according to previously described guidelines (Broeders et al, 2014).

Specificity and sensitivity of the tqPCR assay

To test specificity, the tqPCR assay was performed with total nucleic acids extracted from eight viral samples (PCV1, PCV2, PCV3, PCV4, type 1 and 2 PRRSV, CSFV, and PPV) and two non-infected cultured cells (ST and PK-15 cells) of porcine-origin as negative controls. The sensitivity of the tqPCR and its corresponding monoplex qPCR assays was determined in triplicate using serial dilutions (from 106 to 100 copies/μL) of each standard plasmid DNA containing the capsid genes of PCV2, PCV3, or PCV4 mentioned above. For data analysis, CFX96 Touch Real-Time PCR detection software (Bio-Rad) was used to create a standard curve with the threshold cycle (Ct) values of each 10-fold dilutions of the standard PCV plasmid DNA (from 106 to 100 copies/μL). The detection software calculated the correlation coefficient (R2) of the standard curve, standard deviations, and the copy numbers of PCV2, PCV3, and PCV4 DNAs of the samples, based on the standard curves.

Precision of the tqPCR assay

Repeatability (intra-assay precision) and reproducibility (inter-assay precision) of the tqPCR assay for PCV2, PCV3, and PCV4 were determined using three different concentrations of each viral DNA standard. The concentrations of the PCV2, PCV3, and PCV4 standard DNA were 106, 104, and 102 copies/μL (high, medium, and low), respectively. For intra-assay variability, each dilution was analyzed in triplicate on the same day, whereas for inter-assay variability, each dilution was analyzed in six independent experiments performed by two different operators on different days according to the MIQE guidelines (Bustin et al, 2009). The coefficient of variation for Ct values was determined based on intra- or inter-assay results.

Clinical application of the tqPCR assay for PCV detection

To evaluate the diagnostic performance of the tqPCR assay for differential detection of PCV2, PCV3, and PCV4, 1476 clinical samples collected from 198 Korean domestic pig farms were tested. The tqPCR results were compared with those of each monoplex qPCR assay for PCV2, PCV3, or PCV4 with clinical samples described above. Monoplex qPCR assays with each viral capsid gene-specific primers and probe set were performed using a commercial qPCR kit (RealHelix™ qPCR kit Probe, NanoHelix) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad) as previously described reaction conditions (Kim et al, 2017; Chen et al, 2022). The diagnostic concordance between tqPCR and each monoplex qPCR was determined using Cohen’s kappa statistics at a 95% confidence interval (CI) (Kwiecien et al, 2011). Given a calculated kappa coefficient value of 0.81∼1.0, the results from these assays were almost 100% concordant. Furthermore, the prevalence and co-infection status of PCV2, PCV3, and PCV4 in domestic Korean pig farms were analyzed using the tqPCR results of clinical samples.

Optimal conditions of the tqPCR assay

For simultaneous and differential detection of PCV2, PCV3, and PCV4 capsid genes in a single reaction tube, the primer and probe concentrations were optimized under the same qPCR conditions in a triplex format. The tqPCR using the optimized primer and probe concentrations (0.3 μM of each primer and 0.15 μM of each probe for PCV2 and PCV3, and 0.4 μM of each primer and 0.4 μM of the probe for PCV4) simultaneously detected the fluorescent signals of FAM, ROX, and Cy5 (Fig. 1). The standard curve for each monoplex qPCR or tqPCR revealed a linear relationship between the log copy number and Ct value; the correlation coefficient (R2) over the entire concentration range was determined to be >0.99 for each monoplex qPCR or tqPCR, demonstrating that the developed tqPCR assay is highly quantitative (Fig. 2). Therefore, the newly developed tqPCR assay can quantitatively amplify the three target genes of PCV2, PCV3, and PCV4 in a single reaction without spurious amplification or significant crosstalk between the three fluorescent reporter dyes (Fig. 1, 2).

Fig. 1.Sensitivities of monoplex and triplex real-time PCR (qPCR) assays for PCV2, PCV3, and PCV4. (A∼C) Monoplex qPCR assays for PCV2, PCV3, and PCV4; (D) triplex qPCR assay for PCV2, PCV3, and PCV4. Each monoplex and triplex qPCR assay was performed using 10-fold serial dilutions of viral DNA (106 to 100 copies/μL, lines 1∼7). NC, negative control.

Fig. 2.Standard curves were generated from monoplex and triplex real-time PCR (qPCR) assays using PCV2, PCV3, and PCV4 DNA standards. (A∼C) Monoplex qPCR for PCV2, PCV3, and PCV4, respectively; (D) triplex qPCR for simultaneous detection of PCV2, PCV3, and PCV4. The monoplex and triplex qPCR assays were performed using 10-fold serial dilutions of each viral DNA standard in triplicate. Serial 10-fold dilutions of viral DNA standard (106 to 100 copies/μL) were plotted against the threshold cycle (Ct). The correlation coefficient value (R2) and the equation of the regression curve (y) were calculated using CFX Maestro software (Bio-Rad).

Specificity and sensitivity of the tqPCR assay

Each set of primers and probes for PCV2, PCV3, and PCV4 specifically amplified the target DNA of the respective virus only. No positive results were obtained for any of the other swine pathogens or the two swine-origin cell cultures (Fig. 3A∼3C). As expected, the capsid genes of PCV2, PCV3, and PCV4 were co-amplified using tqPCR from a mixed sample of PCV2, PCV3, and PCV4 DNA (Fig. 3D). These results indicate that the tqPCR assay can be applied for differential detection of PCV2, PCV3, and PCV4 in a single reaction tube (Fig. 1D). The limit of detection for the tqPCR assay was below 10 copies/µL of the capsid gene for PCV2, PCV3, and PCV4, which was consistent with that of each monoplex qPCR (Fig. 1).

Fig. 3.Specificity of monoplex and triplex real-time PCR (qPCR) assays using PCV2, PCV3, and PCV4-specific primers and probe set. (A∼C) Amplification curve of monoplex qPCR for PCV2, PCV3, and PCV4, respectively; (D) amplification curves of triplex qPCR for PCV2, PCV3, and PCV4.

Precision of the tqPCR assay

The coefficients of variation within runs (intra-assay variability) were 0.02% to 0.60% for PCV2, 0.07% to 0.20% for PCV3, and 0.14% to 0.72% for PCV4. The inter-assay variabilities were 0.83% to 1.39% for PCV2, 1.09% to 1.92% for PCV3, and 0.93% to 2.07% for PCV4 (Table 2). Therefore, the assay showed high repeatability and reproducibility, with coefficients of intra-assay and inter-assay variation of less than 3%.

Table 2 . Intra- and inter-assay coefficient of variation of the triplex real-time polymerase chain reaction for PCV2, PCV3 and PCV4

Dilution (copies/µL)Coefficient of variation (%) for PCVs

PCV2PCV3PCV4



Intra-assayInter-assayIntra-assayInter-assayIntra-assayInter-assay
High (106)0.470.830.201.090.721.59
Medium (104)0.021.090.121.270.140.93
Low (102)0.601.390.071.920.392.07

PCV, porcine circoviruses.



Clinical evaluation of tqPCR assay

For clinical evaluation of the newly developed tqPCR assay and investigation of prevalence and co-infection status of PCVs in Korean pig farms, 1476 clinical samples collected from 198 pig farms were tested using the tqPCR and each monoplex qPCR assays. The results were in 100% agreement with those of previously reported monoplex qPCR assays for PCV2, PCV3, and PCV4 (Kim et al, 2017; Chen et al, 2022), regardless of the tested sample type, with a κ value (95% CI) of 1 (1.00∼1.00), indicating that the diagnostic monoplex qPCR results were 100% concordant with the tqPCR assay (Table 3). These results demonstrate that the newly developed tqPCR assay can be applied for simultaneous and differential diagnosis of PCV2, PCV3, and PCV4 in field samples. The individual pig-level prevalence of PCV2, PCV3, and PCV4 in 1476 clinical samples tested was 13.8% (203/1476), 25.4% (375/1476), and 3.8% (56/1476), respectively (Fig. 4A). The co-infection analysis of clinical samples indicated that the single infection rates for PCV2, PCV3, and PCV4 were 8.7% (129/1476), 20.2% (298/1476), and 2.3% (34/1476), respectively. The dual infection rates for PCV2 and PCV3, PCV2 and PCV4, and PCV3 and PCV4 were 4.3% (63/1476), 0.5% (8/1476), and 0.7% (11/1476), respectively. The triple infection rate for PCV2, PCV3, and PCV4 was 0.2% (3/1476) (Fig. 4A). The prevalence of PCV2, PCV3, and PCV4 at the pig farm level was 46.5% (92/198), 63.6% (126/198), and 19.7% (39/198), respectively (Fig. 4B). The farm-level single infection rates for PCV2, PCV3, and PCV4 were 28.8% (57/198), 44.4% (88/198), and 9.6% (19/198), respectively. As a result of analyzing the co-infection status of the pig farms, the dual infection rates of PCV2 and PCV3, PCV2 and PCV4, and PCV3 and PCV4 were 12.6% (25/198), 3.5% (7/198), and 5.1% (10/198), respectively. The farm-level triple infection rate for PCV2, PCV3, and PCV4 was 1.5% (3/198) (Fig. 4B). These results reveal that PCV4 is widely spread, and its co-infection with PCV2 and PCV3 is common in Korean pig herds.

Table 3 . Comparative evaluation of triplex real-time polymerase chain reaction (qPCR) assay for detection of PCV2, PCV3, and PCV4 from clinical pig samples collected in 2019 and 2020

SamplesNo. of tested samplesNo. of positive by monoplex qPCR (%)No. of positive by triplex qPCR (%)


PCV2PCV3PCV4PCV2PCV3PCV4
Serum1,276142 (11.1)252 (19.7)46 (3.6)142 (11.1)252 (19.7)46 (3.6)
Tissue15843 (27.2)104 (65.8)5 (3.2)43 (27.2)104 (65.8)5 (3.2)
Saliva4218 (42.9)19 (45.2)5 (11.9)18 (42.9)19 (45.2)5 (11.9)
Total1,476203 (13.8)375 (25.4)56 (3.8)203 (13.8)375 (25.4)56 (3.8)

Monoplex qPCR assay for PCV2, PCV3 or PCV4 was performed with each viral capsid gene-specific primers and TaqMan probe set as previously described (Kim et al, 2017; Chen et al, 2022).

PCV, porcine circoviruses.



Fig. 4.Prevalence and co-infection status for PCV2, PCV3, and PCV4 determined using the triplex real-time PCR assay with 1476 clinical pig samples from 198 pig farms in 2019 and 2020. (A) Individual pig-level prevalence and co-infection status; (B) pig farm-level prevalence and co-infection status.

Four genetically distinct porcine circoviruses, namely PCV1, PCV2, PCV3, and PCV4, infect pigs. PCV1 is considered nonpathogenic, whereas PCV2, PCV3, and PCV4 are associated with various clinical symptoms in pigs. Furthermore, co-infection with these viruses is common in Chinese and Korean pig herds (Zhang et al, 2020a; Zhang et al, 2020b; Chen et al, 2021; Hou et al, 2021; Nguyen et al, 2021; Sun et al, 2021; Kim et al, 2022a; Kim et al, 2022b). A reliable triplex diagnostic assay capable of simultaneously detecting PCV2, PCV3, and PCV4 in clinical samples is urgently required for epidemiological and clinical studies and to establish control strategies for PCV2, PCV3, and PCV4 infections.

Recently, a TaqMan probe-based mqPCR assay was developed for differential detection of four PCV species (Chen et al, 2021). The assay was developed in quadruplex format to simultaneously detect PCV1, PCV2, PCV3, and PCV4 in a single reaction, and the PCV4-specific primers and probe targeted to the PCV4 ORF1∼ORF2 region were designed to use two available PCV4 sequences at that time. However, primer self-dimers were generated by inter-molecular interaction between the PCV4 reverse primers as 10 nucleotides at the 3’ end of the reverse primer sequence (5’-ACAGGGATAATGCGTAGTGATCACT-3’) were reversibly complementary to each other. In general, qPCR primer design, primers, and probes with a high possibility of self-complementarity, particularly close to the 3’ end, should be avoided because secondary structures such as hairpins and primer-dimers can be formed and interfere with PCR amplification steps. Moreover, since primer dimers generated by intra- or inter-molecular interaction between primers adversely affect PCR efficiency, primers should be carefully designed to avoid primer dimer formation (Rodríguez et al, 2015). Therefore, we decided to design new PCV4-specific primers and probe sets for the tqPCR assay to avoid the primer designing issues of the mqPCR assay, and to make the target genes of three PCVs the same capsid gene for the tqPCR in the present study.

To establish the tqPCR for simultaneous and differential detection of PCV2, PCV3, and PCV4 in a single reaction, a set of primers and probes that can specifically amplify the capsid gene of PCV4 was designed and combined with two sets of primers and probes for PCV2 and PCV3 capsid genes, as was previously reported (Kim et al, 2017) (Table 1). After optimization of the tqPCR conditions, the tqPCR assay with three sets of PCV2-, PCV3-, and PCV4-specific primers and probes simultaneously and differentially detected PCV2, PCV3, and PCV4 DNAs in a single reaction with high specificity and sensitivity comparable with that of the corresponding monoplex qPCR assays (Fig. 13). The sensitivity of the developed tqPCR assay was <10 copies/μL for PCV2, PCV3, and PCV4, which was comparable to that of previously reported duplex PCR assay for PCV2 and PCV3 (Kim et al, 2017) and like those of SYBR Green (Zhang et al, 2020a; Hou et al, 2021) and TaqMan qPCR assays (Chen et al, 2022) for PCV4. To assess the intra-assay repeatability and inter-assay reproducibility of the tqPCR, three different concentrations of each standard DNA were tested in triplicate on six different runs performed by two different operators on different days (Bustin et al, 2009). As shown in Table 2, the developed tqPCR assay can be used as an accurate and reliable differential diagnostic tool for assessing PCV2, PCV3, and PCV4 (Broeders et al, 2014).

In our study, the prevalence of PCV2, PCV3, and PCV4 at individual pig and pig farm levels was 13.8%, 25.4%, and 3.8%, and 46.5%, 63.6%, and 19.7%, respectively (Fig. 4). The individual pig-level prevalence of PCV4 was consistent with that of a previous report (Nguyen et al, 2021). In contrast, it was lower than those of some Chinese prevalence studies, which reported 12.8% (Zhang et al, 2020b) to 37.5% (Hou et al, 2021). Various factors, such as the country, region, and farm surveyed, the health status of the tested pigs, and the diagnostic method, could explain the differences in the observed prevalence. The prevalence at the farm level was higher than that at the individual pig level, which means that PCV4 is likely to occur endemically in Korean pig farms in the future, like PCV2 and PCV3. Previous studies have revealed that PCV4 has wide tissue tropism and could be a potential pathogen causing different clinical presentations, including PMWS, PDNS, diarrhea, abortion, and neurological symptoms. Furthermore, co-infection of PCV4 with PCV3 and singular infection with PCV4 and other swine pathogens are common in infected pigs (Zhang et al, 2020a; Zhang et al, 2020b; Sun et al, 2021; Tian et al, 2021). In this study, although the scope of the research was limited to the prevalence and co-infection status of three PCVs using the newly developed tqPCR assay, further studies are needed on the co-infection of PCVs with other swine pathogens such as PRRSV and PPV. Through this study, PCV2, PCV2, and PCV3 were found to co-circulate in the form of singular infections and co-infections in Korean pig population (Fig. 4). Although pathogenesis studies have not been conducted in animals with PCV4 isolates, PCV4 is hypothesized to be a potential pathogen associated with various clinical symptoms that are like those of PCV2 or PCV3 infections. Therefore, further etiological, epidemiological, and pathological studies are urgently needed to prepare the clinical impacts of PCV4 single and mixed infections with PCV2, PCV3, and other pathogens.

In the present study, we successfully developed a qPCR assay that could differentially detect PCV2, PCV3, and PCV4 in a single reaction with high specificity, sensitivity, and reliability. Based on the clinical evaluation results of the assay, PCV4 is confirmed to be widespread, and co-infection with three pathogenic PCVs is common in Korean pig herds. The developed tqPCR assay will serve as a promising tool for etiological and epidemiological studies of the three pathogenic PCVs.

This work was supported by the Commercialization Promotion Agency for R&D Outcomes (COMPA) grant funded by the Korean Government (Ministry of Science and ICT) (R&D project No. 1711139487), the Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through the Animal Disease Management Technology Development Program (321015-01-1-CG000), and “Cooperative Research Program for Agriculture Science and Technology Development (Project No. PJ01561102)” funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA), Rural Development Administration (RDA), Republic of Korea.

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study complied with the ethical requirements of the Animal and Plant Quarantine Agency and Kyungpook National University, Republic of Korea.

No potential conflict of interest relevant to this article was reported.

  1. Broeders S, Huber I, Grohmann L, Berben G, Taverniers I, Mazzara M, Morisset D. 2014. Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci Technol 37(2):115-126.
    Pubmed CrossRef
  2. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Wittwer CT. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55(4):611-622.
    Pubmed CrossRef
  3. Chen N, Xiao Y, Li X, Li S, Xie N, Yan X, Zhu J. 2021. Development and application of a quadruplex real-time PCR assay for differential detection of porcine circoviruses (PCV1 to PCV4) in Jiangsu province of China from 2016 to 2020. Transbound Emerg Dis 68(3):1615-1624.
    Pubmed CrossRef
  4. Chen W, Jiang D, Xiao L, Zhang P, Luo Y, Yang Z, Yao X, Wu X. 2022. Development of a real-time TaqMan PCR assay for the detection of porcine circovirus 4. J Vet Res 66(1):29-33.
    Pubmed KoreaMed CrossRef
  5. Fux R, Söckler C, Link EK, Renken C, Krejci R, Sutter G, Eddicks M. 2018. Full genome characterization of porcine circovirus type 3 isolates reveals the existence of two distinct groups of virus strains. Virol J 15(1):25.
    Pubmed KoreaMed CrossRef
  6. Hou CY, Xu T, Zhang LH, Cui JT, Zhang YH, Li XS, Chen HY. 2021. Simultaneous detection and differentiation of porcine circovirus 3 and 4 using a SYBR Green І-based duplex quantitative PCR assay. J Virol Methods 293:114152.
    Pubmed CrossRef
  7. Kalendar R, Schulman AH. 2011. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis. Genomics 98(2):137-144.
    Pubmed CrossRef
  8. Kim DY, Kim HR, Park JH, Kwon NY, Kim JM, Kim JK, Park JH, Lee KK, Kim SH, Kim WI, Park CK. 2022a. Detection of a novel porcine circovirus 4 in Korean pig herds using a loop-mediated isothermal amplification assay. J Virol Methods 299:114350.
    Pubmed CrossRef
  9. Kim HR, Lim DR, Chae HG, Park JY, Kim SH, Lee KK, Lee C, Park CK. 2020. Advanced target-specific probe-based real-time loop-mediated isothermal amplification assay for the rapid and specific detection of porcine circovirus 3. Transbound Emerg Dis 67(6):336-2344.
    Pubmed CrossRef
  10. Kim HR, Park J, Park JH, Kim JM, Baek KS, Kim DY, Park CK. 2022b. Development of a real-time polymerase chain reaction assay for reliable detection of a novel porcine circovirus 4 with an endogenous internal positive control. Korean J Vet Serv 45(1):1-11.
    CrossRef
  11. Kim HR, Park YR, Lim DR, Park MJ, Park JY, Kim SH, Lee KK, Park CK. 2017. Multiplex real-time polymerase chain reaction for the differential detection of porcine circovirus 2 and 3. J Virol Methods 250:11-16.
    Pubmed CrossRef
  12. Klaumann F, Correa-Fiz F, Sibila M, Segalés J. 2019. Infection dynamics of porcine circovirus type 3 in longitudinally sampled pigs from four Spanish farms. Vet Rec 184(20):619-619.
    Pubmed CrossRef
  13. Ku X, Chen F, Li P, Wang Y, Yu X, Fan S, Qian P, He Q. 2017. Identification and genetic characterization of porcine circovirus type 3 in China. Transbound Emerg Dis 64(3):703-708.
    Pubmed KoreaMed CrossRef
  14. Kwiecien R, Blettner M. 2011. Concordance analysis: part 16 of a series on evaluation of scientific publications. Dtsch Arztebl Int 108(30):515-521.
    Pubmed KoreaMed CrossRef
  15. Kwon T, Yoo SJ, Lyoo YS. 2017. Prevalence of novel porcine circovirus 3 in Korean pig populations. Vet Microbiol 207:178-180.
    Pubmed CrossRef
  16. Li X, Qiao M, Tian K. 2018. A duplex real-time PCR assay for the simultaneous detection of porcine circovirus 2 and circovirus 3. Virol Sin 33(2):181-186.
    Pubmed KoreaMed CrossRef
  17. Navarro E, Serrano-Heras G, Solera J. 2015. Real-time PCR detection chemistry. Clin Chim Acta 439:231-250.
    Pubmed CrossRef
  18. Nguyen VG, Do HQ, Huynh TML, Park YH, Chung HC. 2021. Molecular-based detection, genetic characterization and phylogenetic analysis of porcine circovirus 4 from Korean domestic swine farms. Transbound Emerg Dis 69(2):538-548.
    Pubmed CrossRef
  19. Opriessnig T, Halbur PG. 2007. Porcine circovirus type 2-associated disease: update on current terminology, clinical manifestations, pathogenesis, diagnosis, and intervention strategies. J Vet Diagn Invest 19(6):591-615.
    Pubmed CrossRef
  20. Palinski R, Piñeyro P, Shang P, Yuan F, Guo R, Fang Y, Hause BM. 2017. A novel porcine circovirus distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure. J Virol 91(1):e01879-16.
    Pubmed KoreaMed CrossRef
  21. Park CK, Kim HS. 2004. Genetic characterization of porcine circovirus 2 Korean isolates. Korean J Vet Res 44:571-579.
  22. Park YR, Kim HR, Kim SH, Lee KK, Lyoo YS, Park CK. 2018. Loop-mediated isothermal amplification assay for the rapid and visual detection of novel porcine circovirus 3. J Virol Methods 253:26-30.
    Pubmed CrossRef
  23. Phan TG, Giannitti F, Rossow S, Marthaler D, Knutson TP, Li L, Deng X, Resende T, Delwart E. 2016. Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation. Virol J 13(1):184.
    Pubmed KoreaMed CrossRef
  24. Rodríguez A, Rodríguez M, Andrade MJ. 2015. Design of primers and probes for quantitative real-time PCR methods. Methods Mol Biol 1275:31-56.
    Pubmed CrossRef
  25. Rosario K, Breitbart M, Harrach B, Segalés J, Delwart E, Varsani A. 2017. Revisiting the taxonomy of the family Circoviridae: establishment of the genus Cyclovirus and removal of the genus Gyrovirus. Arch Virol 162(5):1447-1463.
    Pubmed CrossRef
  26. Saraiva GL, Vidigal PMP, Assao VS, Fajardo MLM, Loreto ANS, Fietto JLR, Bressan GC, Lobato ZIP, Silva-Júnior A. 2019. Retrospective detection and genetic characterization of porcine circovirus 3 (PCV3) strains identified between 2006 and 2007 in Brazil. Viruses 11(3):201.
    Pubmed KoreaMed CrossRef
  27. Segalés J. 2012. Porcine circovirus type 2 (PCV2) infections: clinical signs, pathology and laboratory diagnosis. Virus Res 164(1-2):10-19.
    Pubmed CrossRef
  28. Stadejek T, Woźniak A, Biernacka K. 2017. First detection of porcine circovirus type 3 on commercial pig farms in Poland. Transbound Emerg Dis 64(5):1350-1353.
    Pubmed CrossRef
  29. Sun W, Du Q, Han Z, Bi J, Lan T, Zheng M. 2021. Detection and genetic characterization of porcine circovirus 4 (PCV4) in Guangxi, China. Gene 773:145384.
    Pubmed CrossRef
  30. Tian RB, Zhao Y, Cui JT, Zheng HH, Xu T, Hou CY, Wang ZY, Li XS, Chen HY. 2021. Molecular detection and phylogenetic analysis of porcine circovirus 4 in Henan and Shanxi provinces of China. Transbound Emerg Dis 68(2):276-282.
    Pubmed CrossRef
  31. Tischer I, Gelderblom H, Koch MA. 1982. A very small porcine virus with circular single-stranded DNA. Nature 295(5844):64-66.
    Pubmed CrossRef
  32. Tochetto C, Lima DA, Varela APM, Loiko MR, Paim WP, Scheffer CM, Herpich JI, Cerva C, Schmitd C, Cibulski SP, Santos AC, Roehe PM. 2018. Full-Genome sequence of porcine circovirus type 3 recovered from the serum of sows with stillbirths in Brazil. Transbound Emerg Dis 65(1):5-9.
    Pubmed CrossRef
  33. Wang Y, Feng Y, Zheng W, Noll L, Porter E, Potter M, Cino G, Peddireddi L, Liu X, Bai J. 2019. A multiplex real-time PCR assay for the detection and differentiation of the newly emerged porcine circovirus type 3 and continuously evolving type 2 strains in the United States. J Virol Methods 269:7-12.
    Pubmed KoreaMed CrossRef
  34. Yang K, Jiao Z, Zhou D, Guo R, Tian Y. 2019. Development of a multiplex PCR to detect and discriminate porcine circoviruses in clinical specimens. BMC Infect Dis 19(1):1-10.
    Pubmed KoreaMed CrossRef
  35. Zhang D, Bai C, Ge K, Li Y, Gao W, Wang Y. 2020a. Establishment of an SYBR Green-based real-time PCR assay for porcine circovirus type 4 detection. J Virol Methods 285:113963.
    Pubmed CrossRef
  36. Zhang HH, Hu WQ, Li JY, Liu TN, Zhou JY, Xiao CT. 2020b. Novel circovirus species identified in farmed pigs designated as porcine circovirus 4, Hunan province, China. Transbound Emerg Dis 67(3):1057-1061.
    Pubmed CrossRef

Article

Original Article

Korean J. Vet. Serv. 2022; 45(2): 87-99

Published online June 30, 2022 https://doi.org/10.7853/kjvs.2022.45.2.87

Copyright © The Korean Socitety of Veterinary Service.

Prevalence and co-infection status of three pathogenic porcine circoviruses (PCV2, PCV3, and PCV4) by a newly established triplex real-time polymerase chain reaction assay

Hye-Ryung Kim 1, Jonghyun Park 1,2, Won-Il Kim 3, Young S. Lyoo 4, Choi-Kyu Park 1*

1College of Veterinary Medicine & Animal Disease Intervention Center, Kyungpook National University, Daegu 41566, Korea
2DIVA Bio Inc., Daegu 41519, Korea
3College of Veterinary Medicine, Jeonbuk National University, Iksan 54596, Korea
4College of Veterinary Medicine, Konkuk University, Seoul 05029, Korea

Correspondence to:Choi-Kyu Park
E-mail: parkck@knu.ac.kr
https://orcid.org/0000-0002-0784-9061

Received: June 7, 2022; Accepted: June 12, 2022

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0). which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

A novel porcine circovirus 4 (PCV4) was recently emerged in Chinese and Korean pig herds, which provided epidemiological situation where three pathogenic PCVs, PCV2, PCV3, and newly emerged PCV4, could co-infect pig herds in these countries. In this study, a new triplex quantitative real-time polymerase chain reaction (tqPCR) method was developed for the rapid and differential detection of these viruses. The assay specifically amplified each viral capsid gene, whereas no other porcine pathogenic genes were detected. The detection limit of the assay was below 10 copies/μL and the assay showed high repeatability and reproducibility. In the clinical evaluation using 1476 clinical samples from 198 Korean pig farms, the detection rates of PCV2, PCV3 and PCV4 by the tqPCR assay were 13.8%, 25.4%, and 3.8%, respectively, which were 100% agreement with those of previously reported monoplex qPCR assays for PCV2, PCV3, and PCV4, with a κ value (95% CI) of 1 (1.00∼1.00). The prevalence of PCV2, PCV3, and PCV4 at the farm levels were 46.5%, 63.6%, and 19.7%, respectively. The co-infection analysis for tested pig farms showed that single infection rates for PCV2, PCV3, and PCV4 were 28.8%, 44.4%, and 9.6%, respectively, the dual infection rates of PCV2 and PCV3, PCV2 and PCV4, and PCV3 and PCV4 were 12.6%, 3.5%, and 5.1%, respectively, and the triple infection rate for PCV2, PCV3, and PCV4 was 1.5%. These results demonstrate that three pathogenic PCVs are widely spread, and their co-infections are common in Korean pig herds, and the newly developed tqPCR assay will be useful for etiological and epidemiological studies of these pathogenic PCVs.

Keywords: Differential diagnosis, Porcine circoviruses, Triplex real-time PCR

INTRODUCTION

Circoviruses are small non-enveloped DNA viruses containing a single circular, covalently closed, and single-stranded genome, which belongs to the genus Circovirus of the family Circoviridae (Rosario et al, 2017). To date, four species of circoviruses that infect pigs have been identified: porcine circovirus (PCV) type 1 (PCV1), type 2 (PCV2), type 3 (PCV3), and type 4 (PCV4). PCV1 was first recognized as a contaminant of the continuous porcine kidney cell line PK-15 (ATCC-CCL31) and subsequently determined to be nonpathogenic to pigs (Tischer et al, 1982). In contrast, PCV2, identified in diseased pigs in the early 1990s, is now considered a major disease-causing pathogen leading to an immense economic loss in the global swine industry (Opriessnig et al, 2007; Segalés, 2012). The clinical manifestations of PCV2 infections are collectively termed PCV-associated disease (PCVAD), characterized by several clinical conditions, including post-weaning multisystemic wasting syndrome (PMWS), porcine dermatitis, and nephropathy syndrome (PDNS), reproductive disorders, enteritis, proliferative and necrotizing pneumonia, and porcine respiratory disease complex (PRDC). In 2015, a third PCV species, PCV3, was discovered, in the USA, in pigs with PDNS, reproductive failure, myocarditis, and multisystemic inflammation (Phan et al, 2016; Palinski et al, 2017). Since then, PCV3 has been globally identified in pigs with various clinical symptoms consistent with those of PCVAD in several countries, including South America (Tochetto et al, 2018; Saraiva et al, 2019), Europe (Stadejek et al, 2017; Fux et al, 2018; Klaumann et al, 2019), and Asia, particularly China (Ku et al, 2017), and Korea (Kim et al, 2017; Kwon et al, 2017; Park et al, 2018; Kim et al, 2020). More recently, in 2019, a fourth novel and genetically distinct PCV, designated PCV4, was discovered in pigs with PDNS-like clinical syndrome in Hunan province, China (Zhang et al, 2020b). PCV4 infection was further confirmed in diseased and healthy pigs in other provinces in China (Zhang et al, 2020a; Sun et al, 2021; Tian et al, 2021) and Korea (Nguyen et al, 2021; Kim et al, 2022a; Kim et al, 2022b). Since PCV4 is difficult to isolate in vitro using cell culture (Zhang et al, 2020b), molecular diagnostic assays, such as conventional and real-time PCR, are currently used to detect PCV4 in clinical samples. Conventional PCR and quantitative real-time PCR (qPCR) are used for the routine diagnosis of PCV4 because of their high specificity, sensitivity, and ability to detect and differentiate multiple targets simultaneously (Zhang et al, 2020a; Chen et al, 2021; Hou et al, 2021; Tian et al, 2021; Chen et al, 2022; Kim et al, 2022b). The clinical manifestations of PCV3 and PCV4 are similar to those of PCV2, and co-infection with PCV2, PCV3, and PCV4 has been confirmed in pig populations. Therefore, a rapid and reliable diagnostic assay is required for the differential detection of PCV2, PCV3, and PCV4 in the field (Kim et al, 2017; Zhang et al, 2020a; Chen et al, 2021; Sun et al, 2021; Kim et al, 2022b). Several multiplex qPCR (mqPCR) assays have been developed for the simultaneous detection of different types of PCVs, such as duplex qPCR for PCV2 and PCV3 (Kim et al, 2017; Li et al, 2018; Wang et al, 2019); PCV3 and PCV4 (Hou et al, 2021); triplex qPCR for PCV1, PCV2, and PCV3 (Yang et al, 2019); and quadruplex qPCR for PCV1, PCV2, PCV3, and PCV4 (Chen et al, 2021). However, considering the pathogenicity and clinical significance of PCV2, PCV3, and PCV4 in pigs, a new mqPCR method is necessary for differential detection of these three pathogenic PCVs in clinical pig samples. Therefore, in this study, we developed a new triplex qPCR (tqPCR) assay capable of detecting and typing PCV2, PCV3, and PCV4 and evaluated its diagnostic potential using pig samples to investigate the prevalence and co-infection status of the three pathogenic PCVs in Korean pig farms.

MATERIALS AND METHODS

Viruses and samples

PCV2 (PCK0201 strain) (Park et al, 2004), PCV3 (PCK3- 1701 strain) (Kim et al, 2017), and PCV4 (PCV4-K2101 strain) (Kim et al, 2022a) Korean field strains were used to optimize tqPCR conditions. Other porcine viral pathogens, including PCV1 (from infected PK-15 cell culture), type 1 porcine reproductive and respiratory syndrome virus (PRRSV, Lelystad virus), type 2 PRRSV (LMY strain), classical swine fever virus (CSFV, LOM strain), and porcine parvovirus (PPV, NADL-2 strain) were obtained from the Animal and Plant Quarantine Agency and Animal Disease Intervention Center for evaluating specificity. All pathogen samples were stored at −80℃ until use. For clinical evaluation of the tqPCR assay and investigation of prevalence and co-infection status of PCVs, 1476 clinical samples (tissue, serum, or oral fluid) were collected from 198 domestic pig farms that had experienced outbreaks of respiratory and systemic diseases during 2019 and 2020. The tissue samples were homogenized and diluted 10-fold with phosphate-buffered saline (0.1 M, pH 7.4). All samples were frozen and thawed twice, vortexed for 5 min, and centrifuged at 10,000×g (Hanil, Republic of Korea) for 10 min at 4℃. Viral DNA and RNA were extracted from 200 μL of virus stocks and field samples using a TANBead nucleic acid extraction kit with a fully automated magnetic bead operating platform (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan) and eluted into 100 μL of elution buffer, according to the manufacturer’s instructions. For RNA viruses, total RNA was reverse transcribed to cDNA using the Primescript™ 1st strand cDNA synthesis kit (Takara Korea Biomedical Inc., Seoul, Republic of Korea), according to the manufacturer’s instructions. All nucleic acid samples were stored at −80℃.

Construction of DNA standards

Plasmids containing the complete capsid genes of the PCV2 PCK0201 and PCV3 PCK3-1701 strains (GenBank accession numbers MF964236 and MF611876, respectively) were used as DNA standards for PCV2 and PCV3, respectively, as previously reported (Kim et al, 2017). For PCV4, the complete capsid gene was amplified by PCR from a Korean PCV4 strain (PCV4-K2101, GenBank accession number MZ436811) using specific primers (PCV4-1038F 5′-CACTACGCATTATCCCTGTTTG-3′ and PCV4-1741R 5′-ACCCACAGATGCCAATCAGA-3′). PCR was carried out using a commercial kit (PrimeSTAR® GXL DNA Polymerase; Takara, Shiga, Japan) in 50 μL reaction mixtures containing 10 μL of 5X PrimeSTAR GXL buffer, 4 μL of dNTP mixture, 1 μL of PrimeSTAR GXL DNA polymerase, 0.2 μM of each primer, and 5 μL of PCV4 DNA as a template, according to the manufacturer’s instructions. Amplification was carried out using a thermal cycler (Applied Biosystems, USA) under the following conditions: initial denaturation at 98℃ for 1 min, 35 cycles of amplification (10 s at 98℃, 15 s at 55℃, and 2 min at 68℃), and a final extension at 68℃ for 7 min. The amplified product was purified and cloned into pTOP TA V2 vector (TOPcloner™ TA core Kit; Enzynomics, Korea) and transformed into Escherichia coli competent cells according to the manufacturer’s instructions (DH5α chemically competent E. coli; Enzynomics, Republic of Korea). Each plasmid containing the PCV2, PCV3, and PCV4 capsid genes was purified using a commercial kit (GeneAll Expin Combo GP 200 miniprep kit, GeneAll, Seoul, Republic of Korea). DNA concentration of each plasmid was determined by measuring the absorbance at 260 nm using a NanoDrop Lite instrument (Thermo Scientific, Waltham, MA, USA), and the copy number of each cloned gene was quantified as previously described (Kim et al, 2017). PCV2, PCV3, and PCV4 standard DNA samples were serially diluted by 10-fold (from 106 to 100 copies/μL), stored at −80℃, and used as standards for viral DNA quantitation of diagnostic samples.

Primers and probes for tqPCR assay

Three sets of primers and probes were used for differential detection of PCV2, PCV3, and PCV4 to establish the tqPCR assay. The primers and probes specific for capsid genes of PCV2 and PCV3 were taken from previously well-established duplex qPCR assays for simultaneous detection of PCV2 and PCV3 (Kim et al, 2017). The PCV4-specific primers and probe were newly designed using Primer Express software (version 3.0) (Applied Biosystems) based on 49 PCV4 genome sequences, including 47 Chinese and two Korean strains, available at the National Center for Biotechnology Information. To facilitate the establishment of tqPCR, the primers and probe for PCV4 were carefully designed so that their melting temperatures were consistent with those of the previously reported primers and probes for PCV2 and PCV3. No hairpin, self-dimer, or heterodimer formation between the primers and probes for PCV2, PCV3, and PCV4 were confirmed using OligoAnalyzer software (IDT, Inc., Skokie, IL, USA). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to determine the specificity of the primers and probes. Each primer and probe for PCV2, PCV3, and PCV4 showed 100% homology with the corresponding virus sequences. Furthermore, we evaluated the specificity of the qPCR assay using each primer/probe set in silico using FastPCR software, version 5.4 (PrimerDigital Ltd., Finland) following the developer’s instructions (Kalendar et al, 2011). The predictive success rate of the tqPCR with each primer/probe set was 99.4% (1870/1882) for PCV2, 100% (111/111) for PCV3, and 100% (49/49) for PCV4, showing that each tqPCR assay with the selected primer/probe sets was highly specific and could be applied to amplify PCV2, PCV3, or PCV4 capsid genes. For accurate differential detection of PCV2, PCV3, and PCV4 by tqPCR, sequence-specific probes should be labeled with reporter dyes, the fluorescence spectra of which are distinct or show only minimal overlap (Navarro et al, 2015). In this study, for the simultaneous and differential detection of capsid genes of PCV2, PCV3, and PCV4 in a single reaction, probes were labeled differently at the 5′ and 3′ ends with 6-carboxyfluorescein (FAM) and black hole quencher (BHQ) 1 for PCV2, 6-carboxy-X-rhodamine (ROX) and BHQ 2 for PCV3, and cyanine 5 (Cy5) and BHQ 2 for PCV4, according to the manufacturer’s guidelines (BIONICS, Daejeon, Republic of Korea) (Table 1).

Table 1 . Primers and probes for the triplex quantitative real-time polymerase chain reaction assay in this study.

VirusPrimer/probeSequence (5′-3′)*PositionTm (℃)Amplicon (base pairs)Reference
PCV2PCV2FCCAGGAGGGCGTTSTGACT1534∼155261.399Kim et al (2017)
PCV2RCGYTACCGYTGGAGAAGGAA1613∼163258.3
PCV2PFAM-AATGGCATCTTCAACACCCGCCTCT-BHQ11587∼161168.0
PCV3PCV3FCGGTGGGGTCATATGTGTTG1443∼146262.5118Kim et al (2017)
PCV3RCACAGCCGTTACTTCACC1543∼156060
PCV3PROX-CTTTGTCCTGGGTGAGCGCTGGTAG-BHQ21496∼152069.6
PCV4PCV4FTAGTGGCAGAAATTCGACTT1425∼144459.5100In this study
PCV4RGGACTTTATCCCAAAAGGAC1505∼152458.1
PCV4PCy5-CCGGTAATATGCAAATGGGAGGCTG-BHQ21458∼148266.7

*Bold text in sequences of PCV2F and PCV2R primers represent a degenerative base: S, C, or G; Y, C, or T, respectively..

Genome position of primer- and probe-binding sites were derived from the complete genome sequence of PCV2 PCK0201 strain (MF964236), PCV3 PCK3-1701 strain (MF611876), and PCV4 AHG-2019 strain (MK986820)..

PCV, porcine circoviruses..



Optimization of tqPCR conditions

Before optimization of the tqPCR conditions, each monoplex qPCR assay using PCV2-, PCV3-, or PCV4-specific primers and probe set was carried out using a commercial qPCR kit (RealHelix™ qPCR kit Probe, NanoHelix, Daejeon, Korea) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA). To optimize the tqPCR conditions, the concentrations of three sets of each primer and probe were optimized, whereas the other reaction components were maintained at the same concentrations used in the monoplex reactions. The monoplex qPCR and tqPCR cycling programs were the same and comprised the steps 15 min at 95℃ for initial denaturation, followed by 40 cycles at 95℃ for 20 s and 60℃ for 40 s for amplification. Fluorescence signals from FAM, ROX, and Cy5 were detected at the end of each annealing step. To interpret the monoplex and tqPCR results, samples that produced a cycle threshold (Ct) of less than 40 were considered positive, whereas those with a higher Ct value (>40) were considered negative, according to previously described guidelines (Broeders et al, 2014).

Specificity and sensitivity of the tqPCR assay

To test specificity, the tqPCR assay was performed with total nucleic acids extracted from eight viral samples (PCV1, PCV2, PCV3, PCV4, type 1 and 2 PRRSV, CSFV, and PPV) and two non-infected cultured cells (ST and PK-15 cells) of porcine-origin as negative controls. The sensitivity of the tqPCR and its corresponding monoplex qPCR assays was determined in triplicate using serial dilutions (from 106 to 100 copies/μL) of each standard plasmid DNA containing the capsid genes of PCV2, PCV3, or PCV4 mentioned above. For data analysis, CFX96 Touch Real-Time PCR detection software (Bio-Rad) was used to create a standard curve with the threshold cycle (Ct) values of each 10-fold dilutions of the standard PCV plasmid DNA (from 106 to 100 copies/μL). The detection software calculated the correlation coefficient (R2) of the standard curve, standard deviations, and the copy numbers of PCV2, PCV3, and PCV4 DNAs of the samples, based on the standard curves.

Precision of the tqPCR assay

Repeatability (intra-assay precision) and reproducibility (inter-assay precision) of the tqPCR assay for PCV2, PCV3, and PCV4 were determined using three different concentrations of each viral DNA standard. The concentrations of the PCV2, PCV3, and PCV4 standard DNA were 106, 104, and 102 copies/μL (high, medium, and low), respectively. For intra-assay variability, each dilution was analyzed in triplicate on the same day, whereas for inter-assay variability, each dilution was analyzed in six independent experiments performed by two different operators on different days according to the MIQE guidelines (Bustin et al, 2009). The coefficient of variation for Ct values was determined based on intra- or inter-assay results.

Clinical application of the tqPCR assay for PCV detection

To evaluate the diagnostic performance of the tqPCR assay for differential detection of PCV2, PCV3, and PCV4, 1476 clinical samples collected from 198 Korean domestic pig farms were tested. The tqPCR results were compared with those of each monoplex qPCR assay for PCV2, PCV3, or PCV4 with clinical samples described above. Monoplex qPCR assays with each viral capsid gene-specific primers and probe set were performed using a commercial qPCR kit (RealHelix™ qPCR kit Probe, NanoHelix) and CFX96 Touch™ Real-Time PCR detection system (Bio-Rad) as previously described reaction conditions (Kim et al, 2017; Chen et al, 2022). The diagnostic concordance between tqPCR and each monoplex qPCR was determined using Cohen’s kappa statistics at a 95% confidence interval (CI) (Kwiecien et al, 2011). Given a calculated kappa coefficient value of 0.81∼1.0, the results from these assays were almost 100% concordant. Furthermore, the prevalence and co-infection status of PCV2, PCV3, and PCV4 in domestic Korean pig farms were analyzed using the tqPCR results of clinical samples.

RESULTS

Optimal conditions of the tqPCR assay

For simultaneous and differential detection of PCV2, PCV3, and PCV4 capsid genes in a single reaction tube, the primer and probe concentrations were optimized under the same qPCR conditions in a triplex format. The tqPCR using the optimized primer and probe concentrations (0.3 μM of each primer and 0.15 μM of each probe for PCV2 and PCV3, and 0.4 μM of each primer and 0.4 μM of the probe for PCV4) simultaneously detected the fluorescent signals of FAM, ROX, and Cy5 (Fig. 1). The standard curve for each monoplex qPCR or tqPCR revealed a linear relationship between the log copy number and Ct value; the correlation coefficient (R2) over the entire concentration range was determined to be >0.99 for each monoplex qPCR or tqPCR, demonstrating that the developed tqPCR assay is highly quantitative (Fig. 2). Therefore, the newly developed tqPCR assay can quantitatively amplify the three target genes of PCV2, PCV3, and PCV4 in a single reaction without spurious amplification or significant crosstalk between the three fluorescent reporter dyes (Fig. 1, 2).

Figure 1. Sensitivities of monoplex and triplex real-time PCR (qPCR) assays for PCV2, PCV3, and PCV4. (A∼C) Monoplex qPCR assays for PCV2, PCV3, and PCV4; (D) triplex qPCR assay for PCV2, PCV3, and PCV4. Each monoplex and triplex qPCR assay was performed using 10-fold serial dilutions of viral DNA (106 to 100 copies/μL, lines 1∼7). NC, negative control.

Figure 2. Standard curves were generated from monoplex and triplex real-time PCR (qPCR) assays using PCV2, PCV3, and PCV4 DNA standards. (A∼C) Monoplex qPCR for PCV2, PCV3, and PCV4, respectively; (D) triplex qPCR for simultaneous detection of PCV2, PCV3, and PCV4. The monoplex and triplex qPCR assays were performed using 10-fold serial dilutions of each viral DNA standard in triplicate. Serial 10-fold dilutions of viral DNA standard (106 to 100 copies/μL) were plotted against the threshold cycle (Ct). The correlation coefficient value (R2) and the equation of the regression curve (y) were calculated using CFX Maestro software (Bio-Rad).

Specificity and sensitivity of the tqPCR assay

Each set of primers and probes for PCV2, PCV3, and PCV4 specifically amplified the target DNA of the respective virus only. No positive results were obtained for any of the other swine pathogens or the two swine-origin cell cultures (Fig. 3A∼3C). As expected, the capsid genes of PCV2, PCV3, and PCV4 were co-amplified using tqPCR from a mixed sample of PCV2, PCV3, and PCV4 DNA (Fig. 3D). These results indicate that the tqPCR assay can be applied for differential detection of PCV2, PCV3, and PCV4 in a single reaction tube (Fig. 1D). The limit of detection for the tqPCR assay was below 10 copies/µL of the capsid gene for PCV2, PCV3, and PCV4, which was consistent with that of each monoplex qPCR (Fig. 1).

Figure 3. Specificity of monoplex and triplex real-time PCR (qPCR) assays using PCV2, PCV3, and PCV4-specific primers and probe set. (A∼C) Amplification curve of monoplex qPCR for PCV2, PCV3, and PCV4, respectively; (D) amplification curves of triplex qPCR for PCV2, PCV3, and PCV4.

Precision of the tqPCR assay

The coefficients of variation within runs (intra-assay variability) were 0.02% to 0.60% for PCV2, 0.07% to 0.20% for PCV3, and 0.14% to 0.72% for PCV4. The inter-assay variabilities were 0.83% to 1.39% for PCV2, 1.09% to 1.92% for PCV3, and 0.93% to 2.07% for PCV4 (Table 2). Therefore, the assay showed high repeatability and reproducibility, with coefficients of intra-assay and inter-assay variation of less than 3%.

Table 2 . Intra- and inter-assay coefficient of variation of the triplex real-time polymerase chain reaction for PCV2, PCV3 and PCV4.

Dilution (copies/µL)Coefficient of variation (%) for PCVs

PCV2PCV3PCV4



Intra-assayInter-assayIntra-assayInter-assayIntra-assayInter-assay
High (106)0.470.830.201.090.721.59
Medium (104)0.021.090.121.270.140.93
Low (102)0.601.390.071.920.392.07

PCV, porcine circoviruses..



Clinical evaluation of tqPCR assay

For clinical evaluation of the newly developed tqPCR assay and investigation of prevalence and co-infection status of PCVs in Korean pig farms, 1476 clinical samples collected from 198 pig farms were tested using the tqPCR and each monoplex qPCR assays. The results were in 100% agreement with those of previously reported monoplex qPCR assays for PCV2, PCV3, and PCV4 (Kim et al, 2017; Chen et al, 2022), regardless of the tested sample type, with a κ value (95% CI) of 1 (1.00∼1.00), indicating that the diagnostic monoplex qPCR results were 100% concordant with the tqPCR assay (Table 3). These results demonstrate that the newly developed tqPCR assay can be applied for simultaneous and differential diagnosis of PCV2, PCV3, and PCV4 in field samples. The individual pig-level prevalence of PCV2, PCV3, and PCV4 in 1476 clinical samples tested was 13.8% (203/1476), 25.4% (375/1476), and 3.8% (56/1476), respectively (Fig. 4A). The co-infection analysis of clinical samples indicated that the single infection rates for PCV2, PCV3, and PCV4 were 8.7% (129/1476), 20.2% (298/1476), and 2.3% (34/1476), respectively. The dual infection rates for PCV2 and PCV3, PCV2 and PCV4, and PCV3 and PCV4 were 4.3% (63/1476), 0.5% (8/1476), and 0.7% (11/1476), respectively. The triple infection rate for PCV2, PCV3, and PCV4 was 0.2% (3/1476) (Fig. 4A). The prevalence of PCV2, PCV3, and PCV4 at the pig farm level was 46.5% (92/198), 63.6% (126/198), and 19.7% (39/198), respectively (Fig. 4B). The farm-level single infection rates for PCV2, PCV3, and PCV4 were 28.8% (57/198), 44.4% (88/198), and 9.6% (19/198), respectively. As a result of analyzing the co-infection status of the pig farms, the dual infection rates of PCV2 and PCV3, PCV2 and PCV4, and PCV3 and PCV4 were 12.6% (25/198), 3.5% (7/198), and 5.1% (10/198), respectively. The farm-level triple infection rate for PCV2, PCV3, and PCV4 was 1.5% (3/198) (Fig. 4B). These results reveal that PCV4 is widely spread, and its co-infection with PCV2 and PCV3 is common in Korean pig herds.

Table 3 . Comparative evaluation of triplex real-time polymerase chain reaction (qPCR) assay for detection of PCV2, PCV3, and PCV4 from clinical pig samples collected in 2019 and 2020.

SamplesNo. of tested samplesNo. of positive by monoplex qPCR (%)No. of positive by triplex qPCR (%)


PCV2PCV3PCV4PCV2PCV3PCV4
Serum1,276142 (11.1)252 (19.7)46 (3.6)142 (11.1)252 (19.7)46 (3.6)
Tissue15843 (27.2)104 (65.8)5 (3.2)43 (27.2)104 (65.8)5 (3.2)
Saliva4218 (42.9)19 (45.2)5 (11.9)18 (42.9)19 (45.2)5 (11.9)
Total1,476203 (13.8)375 (25.4)56 (3.8)203 (13.8)375 (25.4)56 (3.8)

Monoplex qPCR assay for PCV2, PCV3 or PCV4 was performed with each viral capsid gene-specific primers and TaqMan probe set as previously described (Kim et al, 2017; Chen et al, 2022)..

PCV, porcine circoviruses..



Figure 4. Prevalence and co-infection status for PCV2, PCV3, and PCV4 determined using the triplex real-time PCR assay with 1476 clinical pig samples from 198 pig farms in 2019 and 2020. (A) Individual pig-level prevalence and co-infection status; (B) pig farm-level prevalence and co-infection status.

DISCUSSION

Four genetically distinct porcine circoviruses, namely PCV1, PCV2, PCV3, and PCV4, infect pigs. PCV1 is considered nonpathogenic, whereas PCV2, PCV3, and PCV4 are associated with various clinical symptoms in pigs. Furthermore, co-infection with these viruses is common in Chinese and Korean pig herds (Zhang et al, 2020a; Zhang et al, 2020b; Chen et al, 2021; Hou et al, 2021; Nguyen et al, 2021; Sun et al, 2021; Kim et al, 2022a; Kim et al, 2022b). A reliable triplex diagnostic assay capable of simultaneously detecting PCV2, PCV3, and PCV4 in clinical samples is urgently required for epidemiological and clinical studies and to establish control strategies for PCV2, PCV3, and PCV4 infections.

Recently, a TaqMan probe-based mqPCR assay was developed for differential detection of four PCV species (Chen et al, 2021). The assay was developed in quadruplex format to simultaneously detect PCV1, PCV2, PCV3, and PCV4 in a single reaction, and the PCV4-specific primers and probe targeted to the PCV4 ORF1∼ORF2 region were designed to use two available PCV4 sequences at that time. However, primer self-dimers were generated by inter-molecular interaction between the PCV4 reverse primers as 10 nucleotides at the 3’ end of the reverse primer sequence (5’-ACAGGGATAATGCGTAGTGATCACT-3’) were reversibly complementary to each other. In general, qPCR primer design, primers, and probes with a high possibility of self-complementarity, particularly close to the 3’ end, should be avoided because secondary structures such as hairpins and primer-dimers can be formed and interfere with PCR amplification steps. Moreover, since primer dimers generated by intra- or inter-molecular interaction between primers adversely affect PCR efficiency, primers should be carefully designed to avoid primer dimer formation (Rodríguez et al, 2015). Therefore, we decided to design new PCV4-specific primers and probe sets for the tqPCR assay to avoid the primer designing issues of the mqPCR assay, and to make the target genes of three PCVs the same capsid gene for the tqPCR in the present study.

To establish the tqPCR for simultaneous and differential detection of PCV2, PCV3, and PCV4 in a single reaction, a set of primers and probes that can specifically amplify the capsid gene of PCV4 was designed and combined with two sets of primers and probes for PCV2 and PCV3 capsid genes, as was previously reported (Kim et al, 2017) (Table 1). After optimization of the tqPCR conditions, the tqPCR assay with three sets of PCV2-, PCV3-, and PCV4-specific primers and probes simultaneously and differentially detected PCV2, PCV3, and PCV4 DNAs in a single reaction with high specificity and sensitivity comparable with that of the corresponding monoplex qPCR assays (Fig. 13). The sensitivity of the developed tqPCR assay was <10 copies/μL for PCV2, PCV3, and PCV4, which was comparable to that of previously reported duplex PCR assay for PCV2 and PCV3 (Kim et al, 2017) and like those of SYBR Green (Zhang et al, 2020a; Hou et al, 2021) and TaqMan qPCR assays (Chen et al, 2022) for PCV4. To assess the intra-assay repeatability and inter-assay reproducibility of the tqPCR, three different concentrations of each standard DNA were tested in triplicate on six different runs performed by two different operators on different days (Bustin et al, 2009). As shown in Table 2, the developed tqPCR assay can be used as an accurate and reliable differential diagnostic tool for assessing PCV2, PCV3, and PCV4 (Broeders et al, 2014).

In our study, the prevalence of PCV2, PCV3, and PCV4 at individual pig and pig farm levels was 13.8%, 25.4%, and 3.8%, and 46.5%, 63.6%, and 19.7%, respectively (Fig. 4). The individual pig-level prevalence of PCV4 was consistent with that of a previous report (Nguyen et al, 2021). In contrast, it was lower than those of some Chinese prevalence studies, which reported 12.8% (Zhang et al, 2020b) to 37.5% (Hou et al, 2021). Various factors, such as the country, region, and farm surveyed, the health status of the tested pigs, and the diagnostic method, could explain the differences in the observed prevalence. The prevalence at the farm level was higher than that at the individual pig level, which means that PCV4 is likely to occur endemically in Korean pig farms in the future, like PCV2 and PCV3. Previous studies have revealed that PCV4 has wide tissue tropism and could be a potential pathogen causing different clinical presentations, including PMWS, PDNS, diarrhea, abortion, and neurological symptoms. Furthermore, co-infection of PCV4 with PCV3 and singular infection with PCV4 and other swine pathogens are common in infected pigs (Zhang et al, 2020a; Zhang et al, 2020b; Sun et al, 2021; Tian et al, 2021). In this study, although the scope of the research was limited to the prevalence and co-infection status of three PCVs using the newly developed tqPCR assay, further studies are needed on the co-infection of PCVs with other swine pathogens such as PRRSV and PPV. Through this study, PCV2, PCV2, and PCV3 were found to co-circulate in the form of singular infections and co-infections in Korean pig population (Fig. 4). Although pathogenesis studies have not been conducted in animals with PCV4 isolates, PCV4 is hypothesized to be a potential pathogen associated with various clinical symptoms that are like those of PCV2 or PCV3 infections. Therefore, further etiological, epidemiological, and pathological studies are urgently needed to prepare the clinical impacts of PCV4 single and mixed infections with PCV2, PCV3, and other pathogens.

In the present study, we successfully developed a qPCR assay that could differentially detect PCV2, PCV3, and PCV4 in a single reaction with high specificity, sensitivity, and reliability. Based on the clinical evaluation results of the assay, PCV4 is confirmed to be widespread, and co-infection with three pathogenic PCVs is common in Korean pig herds. The developed tqPCR assay will serve as a promising tool for etiological and epidemiological studies of the three pathogenic PCVs.

ACKNOWLEDGEMENTS

This work was supported by the Commercialization Promotion Agency for R&D Outcomes (COMPA) grant funded by the Korean Government (Ministry of Science and ICT) (R&D project No. 1711139487), the Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through the Animal Disease Management Technology Development Program (321015-01-1-CG000), and “Cooperative Research Program for Agriculture Science and Technology Development (Project No. PJ01561102)” funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA), Rural Development Administration (RDA), Republic of Korea.

ETHICS STATEMENT

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study complied with the ethical requirements of the Animal and Plant Quarantine Agency and Kyungpook National University, Republic of Korea.

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

Fig 1.

Figure 1.Sensitivities of monoplex and triplex real-time PCR (qPCR) assays for PCV2, PCV3, and PCV4. (A∼C) Monoplex qPCR assays for PCV2, PCV3, and PCV4; (D) triplex qPCR assay for PCV2, PCV3, and PCV4. Each monoplex and triplex qPCR assay was performed using 10-fold serial dilutions of viral DNA (106 to 100 copies/μL, lines 1∼7). NC, negative control.
Korean Journal of Veterinary Service 2022; 45: 87-99https://doi.org/10.7853/kjvs.2022.45.2.87

Fig 2.

Figure 2.Standard curves were generated from monoplex and triplex real-time PCR (qPCR) assays using PCV2, PCV3, and PCV4 DNA standards. (A∼C) Monoplex qPCR for PCV2, PCV3, and PCV4, respectively; (D) triplex qPCR for simultaneous detection of PCV2, PCV3, and PCV4. The monoplex and triplex qPCR assays were performed using 10-fold serial dilutions of each viral DNA standard in triplicate. Serial 10-fold dilutions of viral DNA standard (106 to 100 copies/μL) were plotted against the threshold cycle (Ct). The correlation coefficient value (R2) and the equation of the regression curve (y) were calculated using CFX Maestro software (Bio-Rad).
Korean Journal of Veterinary Service 2022; 45: 87-99https://doi.org/10.7853/kjvs.2022.45.2.87

Fig 3.

Figure 3.Specificity of monoplex and triplex real-time PCR (qPCR) assays using PCV2, PCV3, and PCV4-specific primers and probe set. (A∼C) Amplification curve of monoplex qPCR for PCV2, PCV3, and PCV4, respectively; (D) amplification curves of triplex qPCR for PCV2, PCV3, and PCV4.
Korean Journal of Veterinary Service 2022; 45: 87-99https://doi.org/10.7853/kjvs.2022.45.2.87

Fig 4.

Figure 4.Prevalence and co-infection status for PCV2, PCV3, and PCV4 determined using the triplex real-time PCR assay with 1476 clinical pig samples from 198 pig farms in 2019 and 2020. (A) Individual pig-level prevalence and co-infection status; (B) pig farm-level prevalence and co-infection status.
Korean Journal of Veterinary Service 2022; 45: 87-99https://doi.org/10.7853/kjvs.2022.45.2.87

Table 1 . Primers and probes for the triplex quantitative real-time polymerase chain reaction assay in this study.

VirusPrimer/probeSequence (5′-3′)*PositionTm (℃)Amplicon (base pairs)Reference
PCV2PCV2FCCAGGAGGGCGTTSTGACT1534∼155261.399Kim et al (2017)
PCV2RCGYTACCGYTGGAGAAGGAA1613∼163258.3
PCV2PFAM-AATGGCATCTTCAACACCCGCCTCT-BHQ11587∼161168.0
PCV3PCV3FCGGTGGGGTCATATGTGTTG1443∼146262.5118Kim et al (2017)
PCV3RCACAGCCGTTACTTCACC1543∼156060
PCV3PROX-CTTTGTCCTGGGTGAGCGCTGGTAG-BHQ21496∼152069.6
PCV4PCV4FTAGTGGCAGAAATTCGACTT1425∼144459.5100In this study
PCV4RGGACTTTATCCCAAAAGGAC1505∼152458.1
PCV4PCy5-CCGGTAATATGCAAATGGGAGGCTG-BHQ21458∼148266.7

*Bold text in sequences of PCV2F and PCV2R primers represent a degenerative base: S, C, or G; Y, C, or T, respectively..

Genome position of primer- and probe-binding sites were derived from the complete genome sequence of PCV2 PCK0201 strain (MF964236), PCV3 PCK3-1701 strain (MF611876), and PCV4 AHG-2019 strain (MK986820)..

PCV, porcine circoviruses..


Table 2 . Intra- and inter-assay coefficient of variation of the triplex real-time polymerase chain reaction for PCV2, PCV3 and PCV4.

Dilution (copies/µL)Coefficient of variation (%) for PCVs

PCV2PCV3PCV4



Intra-assayInter-assayIntra-assayInter-assayIntra-assayInter-assay
High (106)0.470.830.201.090.721.59
Medium (104)0.021.090.121.270.140.93
Low (102)0.601.390.071.920.392.07

PCV, porcine circoviruses..


Table 3 . Comparative evaluation of triplex real-time polymerase chain reaction (qPCR) assay for detection of PCV2, PCV3, and PCV4 from clinical pig samples collected in 2019 and 2020.

SamplesNo. of tested samplesNo. of positive by monoplex qPCR (%)No. of positive by triplex qPCR (%)


PCV2PCV3PCV4PCV2PCV3PCV4
Serum1,276142 (11.1)252 (19.7)46 (3.6)142 (11.1)252 (19.7)46 (3.6)
Tissue15843 (27.2)104 (65.8)5 (3.2)43 (27.2)104 (65.8)5 (3.2)
Saliva4218 (42.9)19 (45.2)5 (11.9)18 (42.9)19 (45.2)5 (11.9)
Total1,476203 (13.8)375 (25.4)56 (3.8)203 (13.8)375 (25.4)56 (3.8)

Monoplex qPCR assay for PCV2, PCV3 or PCV4 was performed with each viral capsid gene-specific primers and TaqMan probe set as previously described (Kim et al, 2017; Chen et al, 2022)..

PCV, porcine circoviruses..


References

  1. Broeders S, Huber I, Grohmann L, Berben G, Taverniers I, Mazzara M, Morisset D. 2014. Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci Technol 37(2):115-126.
    Pubmed CrossRef
  2. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Wittwer CT. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55(4):611-622.
    Pubmed CrossRef
  3. Chen N, Xiao Y, Li X, Li S, Xie N, Yan X, Zhu J. 2021. Development and application of a quadruplex real-time PCR assay for differential detection of porcine circoviruses (PCV1 to PCV4) in Jiangsu province of China from 2016 to 2020. Transbound Emerg Dis 68(3):1615-1624.
    Pubmed CrossRef
  4. Chen W, Jiang D, Xiao L, Zhang P, Luo Y, Yang Z, Yao X, Wu X. 2022. Development of a real-time TaqMan PCR assay for the detection of porcine circovirus 4. J Vet Res 66(1):29-33.
    Pubmed KoreaMed CrossRef
  5. Fux R, Söckler C, Link EK, Renken C, Krejci R, Sutter G, Eddicks M. 2018. Full genome characterization of porcine circovirus type 3 isolates reveals the existence of two distinct groups of virus strains. Virol J 15(1):25.
    Pubmed KoreaMed CrossRef
  6. Hou CY, Xu T, Zhang LH, Cui JT, Zhang YH, Li XS, Chen HY. 2021. Simultaneous detection and differentiation of porcine circovirus 3 and 4 using a SYBR Green І-based duplex quantitative PCR assay. J Virol Methods 293:114152.
    Pubmed CrossRef
  7. Kalendar R, Schulman AH. 2011. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis. Genomics 98(2):137-144.
    Pubmed CrossRef
  8. Kim DY, Kim HR, Park JH, Kwon NY, Kim JM, Kim JK, Park JH, Lee KK, Kim SH, Kim WI, Park CK. 2022a. Detection of a novel porcine circovirus 4 in Korean pig herds using a loop-mediated isothermal amplification assay. J Virol Methods 299:114350.
    Pubmed CrossRef
  9. Kim HR, Lim DR, Chae HG, Park JY, Kim SH, Lee KK, Lee C, Park CK. 2020. Advanced target-specific probe-based real-time loop-mediated isothermal amplification assay for the rapid and specific detection of porcine circovirus 3. Transbound Emerg Dis 67(6):336-2344.
    Pubmed CrossRef
  10. Kim HR, Park J, Park JH, Kim JM, Baek KS, Kim DY, Park CK. 2022b. Development of a real-time polymerase chain reaction assay for reliable detection of a novel porcine circovirus 4 with an endogenous internal positive control. Korean J Vet Serv 45(1):1-11.
    CrossRef
  11. Kim HR, Park YR, Lim DR, Park MJ, Park JY, Kim SH, Lee KK, Park CK. 2017. Multiplex real-time polymerase chain reaction for the differential detection of porcine circovirus 2 and 3. J Virol Methods 250:11-16.
    Pubmed CrossRef
  12. Klaumann F, Correa-Fiz F, Sibila M, Segalés J. 2019. Infection dynamics of porcine circovirus type 3 in longitudinally sampled pigs from four Spanish farms. Vet Rec 184(20):619-619.
    Pubmed CrossRef
  13. Ku X, Chen F, Li P, Wang Y, Yu X, Fan S, Qian P, He Q. 2017. Identification and genetic characterization of porcine circovirus type 3 in China. Transbound Emerg Dis 64(3):703-708.
    Pubmed KoreaMed CrossRef
  14. Kwiecien R, Blettner M. 2011. Concordance analysis: part 16 of a series on evaluation of scientific publications. Dtsch Arztebl Int 108(30):515-521.
    Pubmed KoreaMed CrossRef
  15. Kwon T, Yoo SJ, Lyoo YS. 2017. Prevalence of novel porcine circovirus 3 in Korean pig populations. Vet Microbiol 207:178-180.
    Pubmed CrossRef
  16. Li X, Qiao M, Tian K. 2018. A duplex real-time PCR assay for the simultaneous detection of porcine circovirus 2 and circovirus 3. Virol Sin 33(2):181-186.
    Pubmed KoreaMed CrossRef
  17. Navarro E, Serrano-Heras G, Solera J. 2015. Real-time PCR detection chemistry. Clin Chim Acta 439:231-250.
    Pubmed CrossRef
  18. Nguyen VG, Do HQ, Huynh TML, Park YH, Chung HC. 2021. Molecular-based detection, genetic characterization and phylogenetic analysis of porcine circovirus 4 from Korean domestic swine farms. Transbound Emerg Dis 69(2):538-548.
    Pubmed CrossRef
  19. Opriessnig T, Halbur PG. 2007. Porcine circovirus type 2-associated disease: update on current terminology, clinical manifestations, pathogenesis, diagnosis, and intervention strategies. J Vet Diagn Invest 19(6):591-615.
    Pubmed CrossRef
  20. Palinski R, Piñeyro P, Shang P, Yuan F, Guo R, Fang Y, Hause BM. 2017. A novel porcine circovirus distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure. J Virol 91(1):e01879-16.
    Pubmed KoreaMed CrossRef
  21. Park CK, Kim HS. 2004. Genetic characterization of porcine circovirus 2 Korean isolates. Korean J Vet Res 44:571-579.
  22. Park YR, Kim HR, Kim SH, Lee KK, Lyoo YS, Park CK. 2018. Loop-mediated isothermal amplification assay for the rapid and visual detection of novel porcine circovirus 3. J Virol Methods 253:26-30.
    Pubmed CrossRef
  23. Phan TG, Giannitti F, Rossow S, Marthaler D, Knutson TP, Li L, Deng X, Resende T, Delwart E. 2016. Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation. Virol J 13(1):184.
    Pubmed KoreaMed CrossRef
  24. Rodríguez A, Rodríguez M, Andrade MJ. 2015. Design of primers and probes for quantitative real-time PCR methods. Methods Mol Biol 1275:31-56.
    Pubmed CrossRef
  25. Rosario K, Breitbart M, Harrach B, Segalés J, Delwart E, Varsani A. 2017. Revisiting the taxonomy of the family Circoviridae: establishment of the genus Cyclovirus and removal of the genus Gyrovirus. Arch Virol 162(5):1447-1463.
    Pubmed CrossRef
  26. Saraiva GL, Vidigal PMP, Assao VS, Fajardo MLM, Loreto ANS, Fietto JLR, Bressan GC, Lobato ZIP, Silva-Júnior A. 2019. Retrospective detection and genetic characterization of porcine circovirus 3 (PCV3) strains identified between 2006 and 2007 in Brazil. Viruses 11(3):201.
    Pubmed KoreaMed CrossRef
  27. Segalés J. 2012. Porcine circovirus type 2 (PCV2) infections: clinical signs, pathology and laboratory diagnosis. Virus Res 164(1-2):10-19.
    Pubmed CrossRef
  28. Stadejek T, Woźniak A, Biernacka K. 2017. First detection of porcine circovirus type 3 on commercial pig farms in Poland. Transbound Emerg Dis 64(5):1350-1353.
    Pubmed CrossRef
  29. Sun W, Du Q, Han Z, Bi J, Lan T, Zheng M. 2021. Detection and genetic characterization of porcine circovirus 4 (PCV4) in Guangxi, China. Gene 773:145384.
    Pubmed CrossRef
  30. Tian RB, Zhao Y, Cui JT, Zheng HH, Xu T, Hou CY, Wang ZY, Li XS, Chen HY. 2021. Molecular detection and phylogenetic analysis of porcine circovirus 4 in Henan and Shanxi provinces of China. Transbound Emerg Dis 68(2):276-282.
    Pubmed CrossRef
  31. Tischer I, Gelderblom H, Koch MA. 1982. A very small porcine virus with circular single-stranded DNA. Nature 295(5844):64-66.
    Pubmed CrossRef
  32. Tochetto C, Lima DA, Varela APM, Loiko MR, Paim WP, Scheffer CM, Herpich JI, Cerva C, Schmitd C, Cibulski SP, Santos AC, Roehe PM. 2018. Full-Genome sequence of porcine circovirus type 3 recovered from the serum of sows with stillbirths in Brazil. Transbound Emerg Dis 65(1):5-9.
    Pubmed CrossRef
  33. Wang Y, Feng Y, Zheng W, Noll L, Porter E, Potter M, Cino G, Peddireddi L, Liu X, Bai J. 2019. A multiplex real-time PCR assay for the detection and differentiation of the newly emerged porcine circovirus type 3 and continuously evolving type 2 strains in the United States. J Virol Methods 269:7-12.
    Pubmed KoreaMed CrossRef
  34. Yang K, Jiao Z, Zhou D, Guo R, Tian Y. 2019. Development of a multiplex PCR to detect and discriminate porcine circoviruses in clinical specimens. BMC Infect Dis 19(1):1-10.
    Pubmed KoreaMed CrossRef
  35. Zhang D, Bai C, Ge K, Li Y, Gao W, Wang Y. 2020a. Establishment of an SYBR Green-based real-time PCR assay for porcine circovirus type 4 detection. J Virol Methods 285:113963.
    Pubmed CrossRef
  36. Zhang HH, Hu WQ, Li JY, Liu TN, Zhou JY, Xiao CT. 2020b. Novel circovirus species identified in farmed pigs designated as porcine circovirus 4, Hunan province, China. Transbound Emerg Dis 67(3):1057-1061.
    Pubmed CrossRef
KJVS
Jun 30, 2022 Vol.45 No.2, pp. 101~99

Stats or Metrics

Share this article on

  • line
  • mail

Related articles in KJVS

Korean Journal of
Veterinary Service

eISSN 2287-7630
pISSN 1225-6552
qr-code Download