Korean Journal of
Veterinary Service

Feline calicivirus (FCV), which belongs to the genus Vesivirus in the family Calicivirus, is one of the most important feline pathogens associated with various clinical manifestations including upper respiratory tract disease (URTD), oral ulcerations, gingivostomatitis, limping syndrome, and virulent systemic disease (Radford et al, 2009). FCV contains a non-enveloped, single-stranded positive-sense RNA genome with a size of approximately 7.5 kb that is organized into three open reading frames (ORF). ORF1 encodes six nonstructural proteins (p5.6, p32, p39, p30, p13 and p76). ORF2 encodes a capsid precursor protein that is cleaved into the N-terminal leader sequence and major capsid protein VP1, and ORF3 encodes a minor capsid protein (VP2) (Radford et al, 2006; Vinjé et al, 2019; Hofmann-Lehmann et al, 2022). VP1 is divided into six regions (A∼F) based largely on sequence conservation. The regions A, B, D, and F are relatively well conserved, whereas regions C and E are variable with significant sequence divergence levels. Variable region E is known to contain the major B-cell epitopes and its variability has been used as the basis of sequence-based methods to differentiate between strains (Radford et al, 1999; Sato et al, 2002; Henzel et al, 2012; Hou et al, 2016). To date, the global FCVs are classified into two genogroups: genogroup I (GI) and genogroup II (GII) based on the genetic diversity of the VP1 gene (Sato et al, 2002; Radford et al, 2006; Pesavento et al, 2008; Afonso et al, 2017; Zhou et al, 2021; Guo et al, 2022).

FCV plays an important role in an outbreak of feline URTD and its co-infection with other respiratory pathogens such as feline herpesvirus 1 (FHV-1), Bordetella (B.) bronchiseptica, Chlamydia (C.) felis, and Mycoplasma (M.) felis was frequently observed in URTD-affected cats (Cai et al, 2002; Helps et al, 2005; Di Martino et al, 2007; Fernandez et al, 2017; Nguyen et al, 2019). Therefore, several laboratory methods such as virus isolation, antibody detection, and viral RNA detection have been applied for the diagnosis of FCV in clinical samples (Radford et al, 2009). However, the antibody detection method is not suitable for a routine diagnostic tool for FCV infection, as antibodies only indicate the contact of the cat with the viral antigen, and not whether the infection is still present. Although virus isolation by cell culture is a sensitive method for detecting replicable FCV, it is not always successful in clinical diagnosis due to the low number of virions in the clinical sample or virus inactivation during sample transport and storage (Radford et al, 2009; Spiri, 2022). Therefore, molecular diagnostic assays for viral RNA detection have been used for routine diagnosis of FCV from clinical samples.

Previously, several gel-based conventional reverse transcription-polymerase chain reaction (cRT-PCR) assays (Sykes et al, 2001; Kim et al, 2020) and real-time quantitative RT-PCR (qRT-PCR) assays (Helps et al, 2005; Chander et al, 2007; Abd-Eldaim et al, 2009; Cao et al, 2022b) have developed for rapid, sensitive, and specific detection of FCV. The higher sensitivity and specificity as well as the fast turn-around time, the qRT-PCR assays are currently preferred over cRT-PCR assays for FCV detection. Moreover, the results of cRT-PCR assays can be monitored by gel electrophoresis of the amplicons, which sometimes produces false positive results due to cross-contamination of pre-amplified DNAs. In contrast, qRT-PCR assays that are performed in a closed system under stringent quality controls make it reduce the risk of cross-contamination and increase the reliability of the assays (Helps et al, 2005; Abd-Eldaim et al, 2009; Cao et al, 2022b). However, the high genetic variability of FCV and the emergence of genetic mutants can negatively affect the performance of existing qRT-PCR assays because genetic variations in the primer and probe-binding regions of the target genes can result in potential mismatches, which can reduce diagnostic sensitivity and lead to false-negative results (Coyne et al, 2012; Berger et al, 2015; Meli et al, 2018; Kim et al, 2020). Therefore, it is necessary to continuously monitor the genetic variation of FCV field strains and, if necessary, redesign the primers and/or probes of the RT-PCR assays to improve their diagnostic sensitivity.

In previous Korean studies, FCV was detected by various methods such as virus isolation (Lee et al, 2021), commercially available cRT-PCR (Park et al, 2015), previously reported cRT-PCR (Kang and Park, 2008), or newly developed in-house cRT-PCR assays (Kim et al, 2020; Yang et al, 2020). However, despite the superior diagnostic sensitivity of qRT-PCR to cRT-PCR, such a qRT-PCR assay that can detect FCV has not yet been developed and applied in Korea. Therefore, in the present study, we developed a more sensitive and specific qRT-PCR assay that can detect FCV strains currently circulating in Korea, evaluated the diagnostic performance of the developed qRT-PCR assay using feline clinical samples, and investigate the prevalence of FCV infection in the current Korean cat population.

Pathogens and clinical samples

An FCV vaccine strain (F9 strain) was used to develop and optimize the newly developed qRT-PCR (new qRT-PCR) assay’s conditions. Other seven feline pathogens, including FHV-1 (593-J strain), feline leukemia virus (FLV, Rickard strain), feline parvovirus (FPV, Philips Roxane strain), feline coronavirus (FCoV, WSU 79-1683(3) strain), B. bronchiseptica (S-55 strain), M. felis (field strain), and C. felis (Baker strain) were obtained from commercially available vaccine company (CAVC) and Animal Disease Intervention Center (ADIC) for evaluating the assay’s specificity. For clinical evaluation of the new qRT-PCR assay, a total of 94 nasopharyngeal samples were obtained from cats with clinical signs of URTD in 2022 through the collaboration of a companion animal health-care company (Postbio Co., Ltd, Guri, Gyeonggi-do, Korea). Total nucleic acids were extracted from 200 µL of samples using a TANBead Nucleic Acid Extraction Kit with a fully automated magnetic bead operating platform (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan), according to the manufacturer’s instructions. All samples and total nucleic acids were allocated and stored at −80℃ until use.

Primers and probe for the new qRT-PCR assay

To design a new set of primers and probe for the new qRT-PCR assay that can detect a wide spectrum of FCV strains, 124 currently available whole genome sequences of FCV strains (four Korean and 120 other countries’ strains) were retrieved from the GenBank database of the National Center for Biotechnology Information (NCBI). Conserved nucleotide sequences within the p30 genes were identified by multiple alignments using the BioEdit Sequence Alignment Editor program (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Based on these conserved sequences, a pair of primers and probe for the new qRT-PCR assay was designed to specifically detect the FCV p30 gene, aided by Geneious Prime (Biomatters Ltd., New Zealand). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to evaluate the specificity of the primers and probe and confirmed that the designed primers and probe for FCV showed 100% homology with the corresponding FCV p30 gene sequences. For the real-time monitoring of the new qRT-PCR results, the probe was labeled at the 5’ and 3’ ends with 6-carboxyfluorescein (FAM) and Black Hole Quencher 1 (BHQ1) according to the manufacturer’s guidelines (BIONICS, Daejeon, Korea) (Table 1).

Table 1 . Primers and probes used in this study.

Method*	Primer/probe	Sequence (5’∼3’)	Amplicon (bp)	Reference
New qRT-PCR	FCV-p30F	GCCAATCAACATGTGGTAAC	111	This study
	FCV-p30R	CACATCATATGCGGCTCTG
	FCV-p30P	FAM-TGTTTGATTTGGCCTGGGCTCTTCG-BHQ1
Previous qRT-PCR	FCV for	GTTGGATGAACTACCCGCCAATC	122	Helps et al (2005)
	FCV rev	CATATGCGGCTCTGATGGCTTGAAACTG
	FCV FQ	FAM- TCGGTGTTTGATTTGGCCTG -BHQ1

*The newly developed real-time reverse transcription-polymerase chain reaction (new qRT-PCR) assay in this study and previously described qRT-PCR (previous qRT-PCR) assay (Helps et al, 2005) used primers and probe targeting the same p30 gene of feline calicivirus (FCV)..

Construction of an RNA standard for qRT-PCR analysis

The partial p30 gene of FCV spanning the amplified regions of the new and previous qRT-PCR assays were amplified by RT-PCR from RNA samples of the FCV F9 vaccine strain using p30 gene-specific primers (forward, 5’-AGTCAGCTTTGGGCGTG-3’ and reverse, 5’-TCTCATCCATCCAGTGACG-3’), which were designed based on the sequence of the FCV F9 vaccine strain (GenBank accession number M86379). Reverse transcription for cDNA synthesis was performed using a commercial kit (PrimeScript™ 1st strand cDNA Synthesis Kit, TaKaRa Bio Inc., Kusatsu, Japan). PCR was performed using a commercial kit (Inclone™ Excel TB 2x kit, Inclone Biotech, Seongnam, Korea) in 25 μL reaction mixture containing 12.5 μL of 2× reaction buffer, 0.4 μM of each primer, and 5 μL of FCV cDNA as a template, according to the manufacturer’s instructions. The amplification was carried out in a thermal cycler (Applied Biosystems, Foster City, California, USA) under the following conditions: initial denaturation at 95℃ for 2 min, followed by 30 cycles at 95℃ for 20 sec, 58℃ for 40 sec, and 72℃ for 45 sec, and a final extension at 72℃ for 5 min. The amplified 267-bp of FCV p30 gene was purified and cloned into the pTOP TA V2 vector using the TOPclone TA core kit (Enzynomics, Daejeon, Korea). The cloned plasmid DNAs were digested with EcoRI (TaKaRa Bio, Kusatsu, Japan), purified using the Expin CleanUP SV kit (GeneAll Biotechnology, Seoul, Korea), and transcribed in vitro using a RiboMAX Large Scale RNA Production System-T7 (Promega, Fitchburg, Wisconsin, USA) according to the manufacturer’s instructions. The copy numbers of RNA transcripts were quantified as previously described (Kim et al, 2023). Ten-fold serial dilutions (10⁶ to 10⁰ copies/reaction) of the RNA transcripts were stored at −80℃ and used as RNA standards for the FCV p30 gene in this study.

Optimization of the new qRT-PCR conditions

The new qRT-PCR was carried out with designed primers and probe using a commercial qRT-PCR kit (RealHelix™ qRT-PCR kit, NanoHelix, Daejeon, Korea) in the CFX96 Touch™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA). The 25 μL reaction containing 1 μL of Enzyme Mix, 12.5 μL of 2× reaction buffer, 0.4 μM of each primer, 0.2 μM probe, and 5 μL RNA template was prepared according to the manufacturer’s instructions. The new qRT-PCR reaction comprised 30 min at 50℃ for reverse transcription, 15 min at 95℃ for initial denaturation, followed by 40 cycles of 95℃ for 15 sec and 60℃ for 60 sec for amplification. The FAM fluorescence signals for the tested samples were measured at the end of each annealing step and the cycle threshold (Ct) values for each sample were calculated by determining the point at which the fluorescence exceeded the threshold limit. To interpret the results of the new qRT-PCR assay, samples that produced a Ct of less than 40 were considered positive, whereas those with a higher Ct value (>40) were considered negative.

Specificity of the new qRT-PCR assay

To evaluate the specificity of the new qRT-PCR assay, the assay was performed using nucleic acid samples obtained from an FCV vaccine strain (F9) and seven other feline pathogens (FHV-1, FLV, FPV, FCoV, B. bronchiseptica, M. felis, and C. felis) as well as two non-infected cultured cells (CRFK and MDCK cells) of feline and canine-origin as negative controls.

Precision of the new qRT-PCR assay

To verify the assay’s precision, intra-assay repeatability and inter-assay reproducibility of the new qRT-PCR assay for FCV detection were determined using three different concentrations (high, medium, and low) of the FCV standard RNA corresponding to 10⁶, 10⁴, and 10² copies/reaction, respectively. For intra-assay variability, each dilution was analyzed in triplicate on the same day, whereas for inter-assay variability, each dilution was analyzed in six independent experiments performed by two different operators on different days, as per the MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) guidelines (Bustin et al, 2009). The coefficient of variation (CV) for the Ct values was determined based on the intra- or inter-assay results and expressed as a percentage of the mean value, together with the standard deviation values.

Reference qRT-PCR assay

The previously reported qRT-PCR (previous qRT-PCR) assay developed by Helps et al. (2005) was adopted as a reference assay in this study because its diagnostic efficiency for FCV was fully validated by several subsequent studies (Berger et al, 2015; Meli et al, 2018; Palombieri et al, 2023) as well as it used primers and probe set specific for the FCV p30 gene sequences that are also targeted by the new qRT-PCR assay developed in this study. The previous qRT-PCR assay was originally developed as a two-step format comprising first RT and subsequent qPCR steps. However, in this study, the previous qRT-PCR assay was performed as a one-step format with the same primers (FCV for and FCV rev) and probe (FCV FQ) using a commercial one-step qRT-PCR kit (NanoHelix) in the CFX96 Touch™ Real-Time PCR detection system (Bio-Rad). To interpret the previous qRT-PCR results, samples with Ct of less than 40 were considered positive, whereas those with no Ct value (>40) were considered negative, according to the same criteria as the new qRT-PCR assay developed in this study.

Comparative sensitivity of the new qRT-PCR assay

For comparative evaluation of analytical sensitivities of the new and previous qRT-PCR assays with the same criteria, the limit of detection (LOD) of the two assays for FCV was determined using 10-fold serial dilutions (ranged from 10⁶ to 10⁰ copies/reaction) of FCV standard RNA in triplicate. For data analysis, CFX96 Touch Real-Time PCR detection software (Bio-Rad) was used to create a standard curve of Ct values obtained from 10-fold dilutions of FCV standard RNA mentioned above. The detection software calculated the correlation coefficient (R²) of the standard curve, the standard deviations of the results, and the FCV RNA copy numbers in the samples were calculated based on the standard curve using the detection software. The efficiencies of the qRT-PCR assays were assessed using a previously described calculation (Bustin et al, 2009; Johnson et al, 2013).

Clinical evaluation of the new qRT-PCR assay

For clinical evaluation, a total of 94 clinical samples collected from respiratory-diseased cats were tested by the new and previous qRT-PCR assays, and the results were compared to each other. Based on the results, inter-assay concordance was analyzed using Cohen’s kappa statistic at a 95% confidence interval (CI). The calculated kappa coefficient value (κ) was interpreted as follows: κ<0.20=slight agreement, 0.21∼0.40=fair agreement, 0.41∼0.60=moderate agreement, 0.61∼0.80=substantial agreement, 0.81∼0.99=almost perfect agreement, and 1=perfect agreement (Kwiecien et al, 2011). If discrepancies were found between the result of the two assays, amplicons obtained from the discrepant samples were sequenced to determine the reason for the discrepancies.

Interpretation of the new qRT-PCR assay

Under optimized concentrations of FCV p30 gene-specific primers and probe (0.4 μM of primers and 0.2 μM of probe), fluorescence signals of the FAM-labeled probe were successfully generated by the new qRT-PCR assay (Fig. 1, 2A). The standard curve generated by the new qRT-PCR assay revealed a linear relationship between the log copy number and Ct value; the correlation coefficient (R²) over the entire concentration range was determined to be >0.99, demonstrating that the new qRT-PCR assay is highly quantitative (Fig. 2B). The amplification efficiency of the new qRT-PCR for the FCV p30 gene was determined as 91.4%, which is an acceptable range for a well-optimized qRT-PCR assay (Bustin et al, 2009; Johnson et al, 2013). These results indicate that the new qRT-PCR assay can efficiently and quantitatively amplify the FCV p30 gene.

Figure 1. Specificity of the newly developed real-time reverse transcription-polymerase chain reaction (qRT-PCR) for the feline calicivirus (FCV). FAM fluorescence signals were generated in the RNA sample extracted from the FCV F9 vaccine strain, but not from the other seven feline pathogens, including feline herpesvirus 1, feline leukemia virus, feline parvovirus, feline coronavirus, Bordetella bronchiseptica, Mycoplasma felis, and Chlamydia felis as well as two non-infected cell cultures (CRFK and MDCK cells).

Figure 2. The limit of detection (LOD) and standard curves of the newly established real-time reverse transcription-polymerase chain reaction (qRT-PCR) and previous qRT-PCR assay. (A, C) LOD of the new and previous qRT-PCR assays with feline calicivirus (FCV) standard RNAs, respectively. Lines 6∼0, 10-fold serial dilutions of the FCV standard RNAs (10⁶∼10⁰ copies/reaction). (B, D) Standard curves of the new and previous qRT-PCR assays were generated by plotting Ct values against based on the 10-fold serial dilutions of the FCV standard RNAs (10⁶∼10⁰ copies/reaction), respectively. The coefficient of determination (R²) and the equation of the regression curve (y) were calculated using the CFX Manager Software (Bio-Rad).

Specificity of the new qRT-PCR assay

The new qRT-PCR assay using a novel FCV p30 gene-specific primers and probe exclusively amplified the target gene of the FCV vaccine strain and no positive results were obtained from seven feline pathogens as well as two non-infected cells (Fig. 1). These results indicate that the primers and probe for the new qRT-PCR assay were highly specific and reliable to detect the FCV p30 gene RNA because it did not produce false-positive results from non-FCV samples.

Precision of the new qRT-PCR assay

To verify the precision of the new qRT-PCR assay, the intra-assay repeatability and inter-assay reproducibility were assessed using three different concentrations (high, medium, and low) of FCV standard RNAs in triplicates in six different runs performed by two operators on different days. The CV within runs (intra-assay variability) or different runs (intra-assay variability) ranged from 0.50% to 0.95% or 1.12% to 1.50% for FCV standard RNAs (Table 2). These results indicate that the new qRT-PCR assay can be used as an accurate and reliable diagnostic tool for FCV.

Table 2 . Intra- and inter-assay coefficient of variation of the newly developed qRT-PCR assay for the detection of feline calicivirus.

Concentration of RNA (copies/reaction)	Intra-assay variability				Inter-assay variability
	Mean	SD	CV (%)		Mean	SD	CV (%)
High (106)	19.29	0.18	0.95		19.04	0.28	1.50
Medium (104)	26.08	0.13	0.50		25.81	0.30	1.15
Low (102)	33.16	0.23	0.70		32.84	0.37	1.12

The mean value, standard deviation (SD), and coefficient of variation (CV) were calculated based on the cycle threshold (Ct) values obtained by the real-time reverse transcription-polymerase chain reaction (qRT-PCR) using three different concentrations of feline calicivirus p30 gene standard RNAs..

Comparative sensitivity of the new qRT-PCR assay

The analytical sensitivity of the new qRT-PCR assay was determined using 10-fold serial dilutions of FCV standard RNAs. The LOD of the new qRT-PCR assay was determined to be 10 RNA copies/reaction for the FCV p30 gene (Fig. 2A, 2B), which was similar to the LOD of the previous qRT-PCR assay (Fig. 2C, 2D). Based on the standard curve for the previous qRT-PCR assay, the assay was highly quantitative (R²>0.99) and had an acceptable amplification efficiency (99.8%) as shown in Fig. 2D. However, the Ct values of the previous qRT-PCR assay were relatively higher than those of the new qRT-PCR assay for the same concentrations of FCV standard RNAs (Fig. 2A, 2C), indicating that the new qRT-PCR assay was more sensitive than the previous qRT-PCR assay for FCV detection.

Clinical diagnostic performance of the qRT-PCR assay

The new qRT-PCR assay detected 45 out of 94 clinical samples as FCV-positive, showing a detection rate of 47.9%, which was higher than the detection rate of the previous qRT-PCR assay (43.6%) (Table 3). All 41 clinical samples that were confirmed as FCV-positive by the previous qRT-PCR assay were also confirmed as FCV-positive by the new qRT-PCR assay. In addition, four more samples that were FCV-negative by the previous qRT-PCR assay were tested positive for FCV, indicating that the diagnostic sensitivity of the new qRT-PCR assay was higher than that of the previous qRT-PCR assay for detecting FCV in clinical samples. The percentages of positive, negative, and overall agreement between the results of the new and previous qRT-PCR assays were 91.1% (41/45), 100.0% (49/49), and 95.7% (90/94), respectively (Table 3). When determining Ct values generated by the new qRT-PCR assay, the Ct values for four discordant samples were 37.66, 28.40, 29.56, and 28.24, respectively (Table 4). Given that the analytical sensitivity of the previous qRT-PCR assay was comparable to that of the new qRT-PCR assay (Fig. 2), it was assumed that the negative results of the previous qRT-PCR assay for four discordant samples were not simply due to its lower sensitivity. To elucidate the cause of the misdiagnosis of the discordant sample, the target gene fragment was amplified using the forward and reverse primers in the previous qRT-PCR assay and sequenced using the Sanger method by a commercial company (BIONICS, Daejeon, Korea). As a result, three DNA fragments obtained from discordant samples with Ct values of 28.40, 29.56, and 28.24 were successfully sequenced except one obtained from a discordant sample with a higher Ct value of 37.66 (Fig. 3). Subsequently, the sequences were aligned with sequences of the primers and probe of previous qRT-PCR assay and we found that there were two (13^th and 15^th bases from the 5’ end of the probe) or three mismatches (3^rd, 6^th, and 13^th bases from the 5’ end of the probe) in the probe binding site of the p30 gene sequences obtained from three discordant samples, whereas no mismatches in the primer binding sites (Fig. 3A). To further demonstrate whether the detection failure of the previous qRT-PCR was due to sequence mismatches of the probe binding site, the discordant sample was retested by SYTO9-based qRT-PCR under the same reaction conditions as the previous qRT-PCR, except that the mismatched probe was excluded. Surprisingly, FCV RNA was successfully amplified from all four discordant samples by SYTO9-based qRT-PCR assay, with a Ct value ranging from 24.71 to 34.01 (Fig. 3B, 3C), which indicates that the results of previous qRT-PCR assay for the discordant samples were false-negative results caused by sequence mismatches in the probe binding site.

. Table 3 . Comparative diagnostic results for the detection of feline calicivirus in feline clinical samples.

Results by different assays		New qRT-PCR			Detection rate	Overall agreement*
		Positive	Negative	Total
Previous qRT-PCR	Positive	41	0	41	43.6%	95.7%
	Negative	4	49	53
	Total	45	49	94
Detection rate		47.9%

*The percentages of positive, negative, and overall agreement between the results of the new real-time reverse transcription-polymerase chain reaction (qRT-PCR) and the previous qRT-PCR assays were 91.1% (41/45), 100.0% (49/49), and 95.7% (90/94), respectively. The calculated kappa coefficient value (95 % confidence interval) between the new and previous qRT-PCR assays was 0.91 (0.83∼1.00)..

. Table 4 . Comparative diagnostic results for discordant clinical samples by different methods.

Discordant sample code	Sample type	Assay results (Ct value)			Sequencing
		New qRT-PCR	Previous qRT-PCR with probe	Previous qRT-PCR without probe*
KNU_F_126	Nasal swab	37.66	No Ct value	34.01	Not sequenced
KNU_F_134	Nasal swab	28.40	No Ct value	24.71	Sequenced
KNU_F_282	Nasal swab	29.56	No Ct value	27.76	Sequenced
KNU_F_288	Rectal swab	28.24	No Ct value	26.62	Sequenced

*The four discordant clinical samples were retested by SYTO9-based real-time reverse transcription-polymerase chain reaction (qRT-PCR) without probe under the same reaction mixtures and conditions as the previous qRT-PCR with probe (Helps et al, 2005)..

Figure 3.

Alignments of the partial p30 gene sequences obtained from discordant samples, and their retested results by SYTO9-based previous real-time reverse transcription polymerase chain reaction (qRT-PCR). (A) Primers and probe binding sites of Helps’s previous qRT-PCR are indicated by black arrows and lines. A dot indicates the same base and a letter with a red background indicates a mismatched base. All genome positions of primers and probes are numbered in accordance with the FCV F9 strain whole genome sequence (Genbank accession No. M86379). Amplification curves (B) and melt peaks (C) were generated by the SYTO9-based qRTPCR without probe under the same reaction mixtures and conditions as the previous qRT-PCR assay for the four discordant clinical samples. KNU_F_126, 134, 282, and 288, sample code of discordant samples; NC, negative control.

FCV is a highly mutagenic RNA virus and global FCV strains have been classified into two genogroups (GI and GII) and further subdivided into several subgroups within each genogroup based on the genetic variability of FCV capsid genes, (Sato et al, 2002; Coyne et al, 2012; Zhou et al, 2021; Cao et al, 2022a; Spiri, 2022). The plasticity of the FCV genome and the co-circulation of genetically diverse FCV strains pose a special challenge to the diagnostic reliability of previously developed cRT-PCR or qRT-PCR assays (Scansen et al, 2004; Berger et al, 2015; Meli et al, 2018; Kim et al, 2020). Therefore, improved RT-PCR assays are required for more sensitive and reliable detection of currently circulating FCVs in cat populations. In the present study, we developed a TaqMan probe-based qRT-PCR assay with newly designed primers and probe for accurate and reliable detection of FCVs circulating in Korea, and the diagnostic sensitivity of the assay was comparatively evaluated with a previously well-established qRT-PCR assay (Helps et al, 2005).

Given the genetic diversity of FCV strains, selecting a conserved target gene region is crucial for designing primers and probe for the new qRT-PCR assay. Since the p30 gene is one of the most conserved genes in the FCV genome, previously reported cRT-PCR and qRT-PCR assays for FCV have designed their primers and probes using the conserved p30 gene sequences (Helps et al, 2002; Scansen et al, 2004; Helps et al, 2005). Therefore, the p30 gene was selected as the target gene for designing the primers and probe set for the new qRT-PCR assay in the present study (Table 1). The established qRT-PCR with newly designed primers and probe specifically amplified the FCV RNA and did not cross-react with nucleic acids from other seven feline pathogens, indicating that the primers and probe set is highly specific to the FCV p30 gene (Fig. 1). The LOD of the new qRT-PCR assay for FCV standard RNA was below 10 copies/reaction, which is comparable to that of the previous qRT-PCR assay (Helps et al, 2005) as shown in Fig. 2. Considering that the LODs for the previous qRT-PCR assays for FCV ORF1 gene ranged from 50 copies/reaction to 100 copies/reaction (Meli et al, 2018; Cao et al, 2022b), the sensitivity of the new qRT-PCR assay was found to be sufficient for the detection of FCV in clinical samples. Moreover, the assay showed high repeatability and reproducibility of the assay, with a coefficient value of intra- and inter-assay variation of <2%. These analytical values indicate that the new qRT-PCR can function as an accurate and reliable tool for the detection of FCV.

In the clinical evaluation using 94 feline clinical samples, 4 samples that were FCV-negative by the previous qRT-PCR assay were confirmed to be FCV-positive by the new qRT-PCR assay, resulting that the detection rate of FCV by the new qRT-PCR assay was higher than that by the previous qRT-PCR assay (Table 3). The reason of the misdiagnosis of the previous qRT-PCR assay for the four discrepant samples was confirmed to be due to mismatched sequences in the probe binding site of the Korean FCVs (Fig. 3). These results showed that the new qRT-PCR assay developed in this study was suitable for detecting FCV strains circulating in Korea. However, considering the high genetic plasticity of FCV, continuous monitoring for genetic mutation of Korean FCVs and revision of the primers and/or probe used in the new qRT-PCR assay are needed to secure the diagnostic accuracy and reliability for FCV circulating in Korea in the future.

The global prevalence of FCV infection varied according to the investigated countries, cat populations, and their health status as well as diagnostic assays used in those studies. Generally, the prevalence of FCV in the diseased cat population (ranging from 7.2% to 47%) was higher in the healthy cat population (ranging from 6.5% to 16.2%) (Cai et al, 2002; Helps et al, 2005; Di Martino et al, 2007; Berger et al, 2015; Fernandez et al, 2017; Liu et al, 2020; Michael et al, 2021). In this study, the prevalence of FCV in cats with URTD clinical signs was determined as 47.9%, which was similar to those in Europe (47%, Helps et al, 2005), Spain (49.6%, Fernandez et al, 2017), and Switzerland (45%, Berger et al, 2015), but higher than those in Japan (21.2%, Cai et al, 2002), China (14.2%, Liu et al, 2020), and the USA (26%, Michael et al, 2021). It was noteworthy that the prevalence of FCV in this study was unexpectedly higher than those of previously reported FCV prevalence in Korea, which ranged from 0% to 7% (Kang and Park, 2008; Kim et al, 2020; Lee and Park, 2022). Various factors may have contributed to making differences in FCV prevalence between this study and previous studies, but we need to pay attention to the diagnostic method used in those studies. Previously, Kang and Park (2008) used the cRT-PCR assay developed by Sykes et al. (2001) for detecting FCV, but no FCV was detected from tested clinical samples by the assay. In a recent Korean study (Kim et al, 2020), Sykes’s cRT-PCR was demonstrated to have very low diagnostic sensitivity for detecting some Korean FCV strains from clinical samples with low viral load (Kim et al, 2020). In that study, the authors applied a newly developed cRT-PCR assay to detect Korean FCVs to overcome the low diagnostic sensitivity of Sykes’s cRT-PCR. However, the detection rate of FCV in stray cats was determined as 2.5% (3/120) by the new cRT-PCR assay, which was much lower than the detection rate in our study, which was determined by the new qRT-PCR assay. Since comparative evaluation for the diagnostic sensitivity of both Kim’s cRT-PCR and our qRT-PCR assays was not performed in this study, it was uncertain that the difference in prevalence between the two studies was generated by the gap of both assay’s diagnostic sensitivity. Therefore, further studies are required to comparatively evaluate the diagnostic performance of the previously described cRT-PCR (Kim et al, 2020) and our newly developed qRT-PCR assays. In this regard, we recently developed several advanced qRT-PCR assays for more sensitive and reliable detection of currently circulating canine and feline pathogens in Korea (Kim et al, 2022; Jeon et al, 2023a; Jeon et al, 2023b; Jeon et al, 2023c). Such an effort to improve the diagnostic performance of the existing molecular diagnostic assays should be continued for reliable diagnosis and surveillance of feline and canine pathogens circulating in Korea.

In conclusion, we successfully developed an improved qRT-PCR assay using newly designed FCV p30 gene-specific primers and probe suitable for detecting FCVs circulating in Korea. Given the high sensitivity, specificity, and accuracy of the developed qRT-PCR assay, the assay will be a valuable tool for etiological and epidemiological studies of FCV infection in the cat population. Furthermore, the prevalence data investigated in this study will contribute to the expansion of epidemiological knowledge about FCV infection in Korea.

This work was supported by the fund (Z-1543085-2022-23-0302) by the Research of Animal and Plant Quarantine Agency, Republic of Korea.

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. This study was conducted in 2022 and was beyond the purview of the Institutional Animal Care and Use Committee (IACUC) at Kyungpook National University (KNU), as the KNU IACUC only evaluates proposals using laboratory animals maintained in indoor facilities and not research involving outdoor animals. Feline clinical samples were collected by practicing veterinarians at local clinics and animal shelters during monitoring, surveillance, and treatment, or during regular medical check-ups, after receiving verbal consent from the owners.

No potential conflict of interest relevant to this article was reported.